Morpholino

MO1-foxa2

ID
ZDB-MRPHLNO-050228-2
Name
MO1-foxa2
Previous Names
None
Target
Sequence
5' - CCTCCATTTTGACAGCACCGAGCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-foxa2
Phenotype
Phenotype resulting from MO1-foxa2
Phenotype of all Fish created by or utilizing MO1-foxa2
Phenotype Fish Conditions Figures
floor plate undifferentiated, abnormal WT + MO1-foxa2 standard conditions Fig. 1 with image from Dal-Pra et al., 2011
post-vent region curved ventral, abnormal WT + MO1-foxa2 standard conditions Fig. 1 with image from Dal-Pra et al., 2011
pancreas development disrupted, abnormal WT + MO1-foxa2 standard conditions Fig. 7 with image from Shin et al., 2008
pancreas decreased size, abnormal WT + MO1-foxa2 standard conditions Fig. 7 with image from Shin et al., 2008
exocrine pancreas decreased size, abnormal gz2Tg; gz4Tg; m1018Tg + MO1-foxa2 standard conditions Fig. 7 with image from Shin et al., 2008
liver development disrupted, abnormal gz2Tg; gz4Tg; m1018Tg + MO1-foxa2 standard conditions Fig. 7 with image from Shin et al., 2008
pancreas development disrupted, abnormal gz2Tg; gz4Tg; m1018Tg + MO1-foxa2 standard conditions Fig. 7 with image from Shin et al., 2008
liver decreased size, abnormal gz2Tg; gz4Tg; m1018Tg + MO1-foxa2 standard conditions Fig. 7 with image from Shin et al., 2008
liver development disrupted, abnormal med12s432/+ + MO1-foxa2 standard conditions Fig. 7 with image from Shin et al., 2008
pancreas decreased size, abnormal med12s432/+ + MO1-foxa2 standard conditions Fig. 7 with image from Shin et al., 2008
liver decreased size, abnormal med12s432/+ + MO1-foxa2 standard conditions Fig. 7 with image from Shin et al., 2008
pancreas development disrupted, abnormal med12s432/+ + MO1-foxa2 standard conditions Fig. 7 with image from Shin et al., 2008
pancreas development disrupted, abnormal med12s432/s432 + MO1-foxa2 standard conditions Fig. 7 with image from Shin et al., 2008
liver development disrupted, abnormal med12s432/s432 + MO1-foxa2 standard conditions Fig. 7 with image from Shin et al., 2008
pancreas aplastic, abnormal med12s432/s432 + MO1-foxa2 standard conditions Fig. 7 with image from Shin et al., 2008
liver aplastic, abnormal med12s432/s432 + MO1-foxa2 standard conditions Fig. 7 with image from Shin et al., 2008
gut duplicated, abnormal AB + MO1-foxa2 + MO3-sox17 standard conditions Fig. 6 with image from Muto et al., 2011
pancreas duplicated, abnormal AB + MO1-foxa2 + MO3-sox17 standard conditions Fig. 6 with image from Muto et al., 2011
liver duplicated, abnormal AB + MO1-foxa2 + MO3-sox17 standard conditions Fig. 6 with image from Muto et al., 2011
axial chorda mesoderm decreased width, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 3 with imageFig. 8 with image from Dal-Pra et al., 2011
somite fused with somite, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with image from Dal-Pra et al., 2011
notochord cell decreased size, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. S1 with image from Dal-Pra et al., 2011
notochord posterior region truncated, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. S2 with image from Dal-Pra et al., 2011
hypochord decreased length, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. S2 with image from Dal-Pra et al., 2011
notochord cell mislocalised, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. S1 with image from Dal-Pra et al., 2011
hypochord disorganized, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. 8 with imageFig. S2 with image from Dal-Pra et al., 2011
floor plate disorganized, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. 8 with imageFig. S2 with image from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 3 with imageFig. 8 with image from Dal-Pra et al., 2011
floor plate cell elongated, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. S1 with image from Dal-Pra et al., 2011
axial chorda mesoderm aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 3 with image from Dal-Pra et al., 2011
floor plate decreased length, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. S2 with image from Dal-Pra et al., 2011
notochord disorganized, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. 8 with imageFig. S2 with image from Dal-Pra et al., 2011
intestine goblet cell agr2 expression decreased amount, abnormal WT + MO1-foxa2 + MO3-hif1ab standard conditions Fig. 6 from Lai et al., 2016
goblet cell cell maturation disrupted, abnormal WT + MO1-foxa2 + MO3-hif1ab standard conditions Fig. 6 from Lai et al., 2016
hypochord aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3 standard conditions Fig. S2 with image from Dal-Pra et al., 2011
notochord aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3 standard conditions Fig. S2 with image from Dal-Pra et al., 2011
floor plate aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3 standard conditions Fig. S2 with image from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
hypochord aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
floor plate aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
axial chorda mesoderm aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
notochord aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
paraxial mesoderm left side fused with paraxial mesoderm right side, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
liver development disrupted, abnormal med12s432/+; gz2Tg; gz4Tg; m1018Tg + MO1-foxa2 standard conditions Fig. 7 with image from Shin et al., 2008
exocrine pancreas decreased size, abnormal med12s432/+; gz2Tg; gz4Tg; m1018Tg + MO1-foxa2 standard conditions Fig. 7 with image from Shin et al., 2008
pancreas development disrupted, abnormal med12s432/+; gz2Tg; gz4Tg; m1018Tg + MO1-foxa2 standard conditions Fig. 7 with image from Shin et al., 2008
liver decreased size, abnormal med12s432/+; gz2Tg; gz4Tg; m1018Tg + MO1-foxa2 standard conditions Fig. 7 with image from Shin et al., 2008
Citations