Morpholino
MO1-prox1a
- ID
- ZDB-MRPHLNO-050225-3
- Name
- MO1-prox1a
- Previous Names
-
- MO1-prox1
- Target
- Sequence
-
5' - ATGTGCTGTCATGGTCAGGCATCAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-prox1a
No data available
Phenotype
Phenotype resulting from MO1-prox1a
1 - 5 of 9 Show all
Phenotype of all Fish created by or utilizing MO1-prox1a
1 - 5 of 10 Show all
Citations
- Veen, K., Krylov, A., Yu, S., He, J., Boyd, P., Hyde, D.R., Mantamadiotis, T., Cheng, L.Y., Jusuf, P.R. (2023) Her6 and Prox1a are novel regulators of photoreceptor regeneration in the zebrafish retina. PLoS Genetics. 19:e1011010e1011010
- Wakayama, Y., Fukuhara, S., Ando, K., Matsuda, M., Mochizuki, N. (2015) Cdc42 Mediates Bmp-Induced Sprouting Angiogenesis through Fmnl3-Driven Assembly of Endothelial Filopodia in Zebrafish. Developmental Cell. 32:109-22
- Del Giacco, L., Pistocchi, A., and Ghilardi, A. (2010) prox1b Activity Is Essential in Zebrafish Lymphangiogenesis. PLoS One. 5(10):e13170
- Flores, M.V., Hall, C.J., Crosier, K.E., and Crosier, P.S. (2010) Visualization of embryonic lymphangiogenesis advances the use of the zebrafish model for research in cancer and lymphatic pathologies. Developmental Dynamics : an official publication of the American Association of Anatomists. 239(7):2128-2135
- Pistocchi, A., Feijoo, C.G., Cabrera, P., Villablanca, E.J., Allende, M.L., and Cotelli, F. (2009) The zebrafish prospero homolog prox1 is required for mechanosensory hair cell differentiation and functionality in the lateral line. BMC Developmental Biology. 9:58
- Pistocchi, A., Bartesaghi, S., Cotelli, F., and Del Giacco, L. (2008) Identification and expression pattern of zebrafish prox2 during embryonic development. Developmental Dynamics : an official publication of the American Association of Anatomists. 237(12):3916-3920
- Pistocchi, A., Gaudenzi, G., Carra, S., Bresciani, E., Del Giacco, L., and Cotelli, F. (2008) Crucial role of zebrafish prox1 in hypothalamic catecholaminergic neurons development. BMC Developmental Biology. 8:27
- Yaniv, K., Isogai, S., Castranova, D., Dye, L., Hitomi, J., and Weinstein, B.M. (2007) Imaging the developing lymphatic system using the zebrafish. Novartis Foundation symposium. 283(1):139-148
- Yaniv, K., Isogai, S., Castranova, D., Dye, L., Hitomi, J., and Weinstein, B.M. (2006) Live imaging of lymphatic development in the zebrafish. Nature medicine. 12(6):711-716
- Liu, Y.W., Gao, W., Teh, H.L., Tan, J.H., and Chan, W.K. (2003) Prox1 is a novel coregulator of Ff1b and is involved in the embryonic development of the zebra fish interrenal primordium. Molecular and cellular biology. 23(20):7243-7255
1 - 10 of 11
Show