Morpholino

MO1-chsy1

ID
ZDB-MRPHLNO-050218-1
Name
MO1-chsy1
Previous Names
  • cs1
  • MO1-chys1 (1)
Target
Sequence
5' - AAGATCTGCGACTCCTTCCTGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Morpholino designed against the translational start site.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-chsy1
No data available
Phenotype
Phenotype resulting from MO1-chsy1
Phenotype Fish Figures
atrioventricular canal aplastic, abnormal AB/TU + MO1-chsy1 Fig. 4 with image,  text only from Peal et al., 2009
blood circulation disrupted, abnormal AB/TU + MO1-chsy1 text only from Peal et al., 2009
ethmoid cartilage malformed, abnormal WT + MO1-chsy1 Fig. 4 from Li et al., 2010
eye fused with eye, abnormal WT + MO1-chsy1 Fig. 4 from Li et al., 2010
forebrain medial region aplastic, abnormal WT + MO1-chsy1 Fig. 4 from Li et al., 2010
head bulbous, abnormal WT + MO1-chsy1 Fig. 4 from Li et al., 2010
heart decreased functionality, abnormal AB/TU + MO1-chsy1 text only from Peal et al., 2009
heart morphogenesis disrupted, abnormal AB/TU + MO1-chsy1 Fig. 4 with image,  text only from Peal et al., 2009
notochord degenerate, abnormal WT + MO1-chsy1 Fig. 4 from Li et al., 2010
notochord undulate, abnormal WT + MO1-chsy1 Fig. 4 from Li et al., 2010
optic fissure present, abnormal WT + MO1-chsy1 Fig. 4 from Li et al., 2010
optic furrow open, abnormal WT + MO1-chsy1 Fig. 4 from Li et al., 2010
pars superior ear morphology, abnormal WT + MO1-chsy1 Fig. 5 from Li et al., 2010
pectoral fin fold decreased size, abnormal WT + MO1-chsy1 Fig. 4 from Li et al., 2010
pectoral fin fold variability of size, abnormal WT + MO1-chsy1 Fig. 4 from Li et al., 2010
post-vent region morphology, abnormal AB/TU + MO1-chsy1 text only from Peal et al., 2009
trabecula cranii malformed, abnormal WT + MO1-chsy1 Fig. 4 from Li et al., 2010
ventral mandibular arch protruding, abnormal WT + MO1-chsy1 Fig. 4 from Li et al., 2010
whole organism decreased length, abnormal WT + MO1-chsy1 Fig. 4 from Li et al., 2010
Phenotype of all Fish created by or utilizing MO1-chsy1
Phenotype Fish Conditions Figures
atrioventricular canal aplastic, abnormal AB/TU + MO1-chsy1 standard conditions Fig. 4 with image,  text only from Peal et al., 2009
post-vent region morphology, abnormal AB/TU + MO1-chsy1 standard conditions text only from Peal et al., 2009
blood circulation disrupted, abnormal AB/TU + MO1-chsy1 standard conditions text only from Peal et al., 2009
heart morphogenesis disrupted, abnormal AB/TU + MO1-chsy1 standard conditions Fig. 4 with image,  text only from Peal et al., 2009
heart decreased functionality, abnormal AB/TU + MO1-chsy1 standard conditions text only from Peal et al., 2009
eye fused with eye, abnormal WT + MO1-chsy1 standard conditions Fig. 4 from Li et al., 2010
pectoral fin fold decreased size, abnormal WT + MO1-chsy1 standard conditions Fig. 4 from Li et al., 2010
pectoral fin fold variability of size, abnormal WT + MO1-chsy1 standard conditions Fig. 4 from Li et al., 2010
optic fissure present, abnormal WT + MO1-chsy1 standard conditions Fig. 4 from Li et al., 2010
ethmoid cartilage malformed, abnormal WT + MO1-chsy1 standard conditions Fig. 4 from Li et al., 2010
head bulbous, abnormal WT + MO1-chsy1 standard conditions Fig. 4 from Li et al., 2010
ventral mandibular arch protruding, abnormal WT + MO1-chsy1 standard conditions Fig. 4 from Li et al., 2010
notochord degenerate, abnormal WT + MO1-chsy1 standard conditions Fig. 4 from Li et al., 2010
optic furrow open, abnormal WT + MO1-chsy1 standard conditions Fig. 4 from Li et al., 2010
trabecula cranii malformed, abnormal WT + MO1-chsy1 standard conditions Fig. 4 from Li et al., 2010
whole organism decreased length, abnormal WT + MO1-chsy1 standard conditions Fig. 4 from Li et al., 2010
pars superior ear morphology, abnormal WT + MO1-chsy1 standard conditions Fig. 5 from Li et al., 2010
notochord undulate, abnormal WT + MO1-chsy1 standard conditions Fig. 4 from Li et al., 2010
forebrain medial region aplastic, abnormal WT + MO1-chsy1 standard conditions Fig. 4 from Li et al., 2010
retina fused with retina, abnormal WT + MO1-chsy1 + MO3-chsy1 standard conditions Fig. 5 from Tian et al., 2010
pectoral fin cartilage disorganized, abnormal WT + MO1-chsy1 + MO3-chsy1 standard conditions Fig. 5 from Tian et al., 2010
otic placode decreased size, abnormal WT + MO1-chsy1 + MO3-chsy1 standard conditions Fig. 4 from Tian et al., 2010
ethmoid cartilage deformed, abnormal WT + MO1-chsy1 + MO3-chsy1 standard conditions Fig. 5 from Tian et al., 2010
somite specification disrupted, abnormal WT + MO1-chsy1 + MO3-chsy1 standard conditions Fig. 4 from Tian et al., 2010
Notch signaling pathway disrupted, abnormal WT + MO1-chsy1 + MO3-chsy1 standard conditions Fig. 4 from Tian et al., 2010
whole organism decreased length, abnormal WT + MO1-chsy1 + MO3-chsy1 standard conditions Fig. 4 from Tian et al., 2010
retinal ganglion cell layer hyperplastic, abnormal WT + MO1-chsy1 + MO3-chsy1 standard conditions Fig. 5 from Tian et al., 2010
chondroitin sulfate proteoglycan biosynthetic process decreased occurrence, abnormal WT + MO1-chsy1 + MO3-chsy1 standard conditions Fig. 3 from Holmborn et al., 2012
optic primordium fused with optic primordium, abnormal WT + MO1-chsy1 + MO3-chsy1 standard conditions Fig. 4 from Tian et al., 2010
pectoral fin endoskeletal disc hypoplastic, abnormal WT + MO1-chsy1 + MO3-chsy1 standard conditions Fig. 5 from Tian et al., 2010
whole organism lacks parts or has fewer parts of type pectoral fin, abnormal WT + MO1-chsy1 + MO3-chsy1 standard conditions Fig. 5 from Tian et al., 2010
eye morphology, abnormal WT + MO1-chsy1 + MO3-chsy1 standard conditions Fig. 4 from Tian et al., 2010
lens decreased size, abnormal WT + MO1-chsy1 + MO3-chsy1 standard conditions Fig. 5 from Tian et al., 2010
retinal pigmented epithelium hyperplastic, abnormal WT + MO1-chsy1 + MO3-chsy1 standard conditions Fig. 5 from Tian et al., 2010
optic stalk morphology, abnormal WT + MO1-chsy1 + MO3-chsy1 standard conditions Fig. 4 from Tian et al., 2010
mandibular arch skeleton decreased size, abnormal WT + MO1-chsy1 + MO3-chsy1 standard conditions Fig. 4,  Fig. 5 from Tian et al., 2010
Meckel's cartilage increased thickness, abnormal extl3tm70g/tm70g; y1Tg + MO1-chsy1 + MO3-chsy1 standard conditions Fig. S5 from Holmborn et al., 2012
ceratohyal cartilage decreased length, abnormal extl3tm70g/tm70g; y1Tg + MO1-chsy1 + MO3-chsy1 standard conditions Fig. S5 from Holmborn et al., 2012
Meckel's cartilage decreased length, abnormal extl3tm70g/tm70g; y1Tg + MO1-chsy1 + MO3-chsy1 standard conditions Fig. S5 from Holmborn et al., 2012
mandibular arch skeleton decreased size, abnormal extl3tm70g/tm70g; y1Tg + MO1-chsy1 + MO3-chsy1 standard conditions Fig. S5 from Holmborn et al., 2012
ceratohyal cartilage increased thickness, abnormal extl3tm70g/tm70g; y1Tg + MO1-chsy1 + MO3-chsy1 standard conditions Fig. S5 from Holmborn et al., 2012
mandibular arch skeleton condensed, abnormal extl3tm70g/tm70g; y1Tg + MO1-chsy1 + MO3-chsy1 standard conditions Fig. S5 from Holmborn et al., 2012
Citations