Morpholino
MO1-gli1
- ID
- ZDB-MRPHLNO-050209-5
- Name
- MO1-gli1
- Previous Names
- Target
- Sequence
-
5' - CCGACACACCCGCTACACCCACAGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gli1
No data available
Phenotype
Phenotype resulting from MO1-gli1
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-gli1
1 - 5 of 9 Show all
Citations
- Maurya, A.K., Ben, J., Zhao, Z., Lee, R.T., Niah, W., Ng, A.S., Iyu, A., Yu, W., Elworthy, S., van Eeden, F.J., and Ingham, P.W. (2013) Positive and negative regulation of Gli activity by Kif7 in the zebrafish embryo. PLoS Genetics. 9(12):e1003955
- Stückemann, T., Wegleiter, T., Stefan, E., Nägele, O., Tarbashevich, K., Böck, G., Raz, E., and Aanstad, P. (2012) Zebrafish Cxcr4a determines the proliferative response to Hedgehog signalling. Development (Cambridge, England). 139(15):2711-2720
- Chalasani, K., and Brewster, R.M. (2011) N-cadherin-mediated cell adhesion restricts cell proliferation in the dorsal neural tube. Molecular biology of the cell. 22(9):1505-1515
- England, S., Batista, M.F., Mich, J.K., Chen, J.K., and Lewis, K.E. (2011) Roles of Hedgehog pathway components and retinoic acid signalling in specifying zebrafish ventral spinal cord neurons. Development (Cambridge, England). 138(23):5121-5134
- Mich, J.K., and Chen, J.K. (2011) Hedgehog and retinoic acid signaling cooperate to promote motoneurogenesis in zebrafish. Development (Cambridge, England). 138(23):5113-5119
- Devine, C.A., Sbrogna, J.L., Guner, B., Osgood, M., Shen, M.C., and Karlstrom, R.O. (2009) A dynamic Gli code interprets Hh signals to regulate induction, patterning, and endocrine cell specification in the zebrafish pituitary. Developmental Biology. 326(1):143-154
- Huang, P., and Schier, A.F. (2009) Dampened Hedgehog signaling but normal Wnt signaling in zebrafish without cilia. Development (Cambridge, England). 136(18):3089-3098
- Ninkovic, J., Stigloher, C., Lillesaar, C., and Bally-Cuif, L. (2008) Gsk3{beta}/PKA and Gli1 regulate the maintenance of neural progenitors at the midbrain-hindbrain boundary in concert with E(Spl) factor activity. Development (Cambridge, England). 135(18):3137-3148
- Masai, I., Yamaguchi, M., Tonou-Fujimori, N., Komori, A., and Okamoto, H. (2005) The hedgehog-PKA pathway regulates two distinct steps of the differentiation of retinal ganglion cells: the cell-cycle exit of retinoblasts and their neuronal maturation. Development (Cambridge, England). 132(7):1539-1553
- Tyurina, O.V., Guner, B., Popova, E., Feng, J., Schier, A.F., Kohtz, J.D., and Karlstrom, R.O. (2005) Zebrafish Gli3 functions as both an activator and a repressor in Hedgehog signaling. Developmental Biology. 277(2):537-556
1 - 10 of 12
Show