Morpholino

MO1-shha

ID
ZDB-MRPHLNO-050204-6
Name
MO1-shha
Previous Names
  • MO(T)-shh
  • MO1-shh (1)
  • shh-MO (2)
Target
Sequence
5' - CAGCACTCTCGTCAAAAGCCGCATT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
A translation blocking morpholino against shh. Embryos have a normal head and u-shaped somites. The myoseptum is absent. The finbuds are reduced compared with wild type embryos.
Genome Resources
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-shha
Phenotype
Phenotype resulting from MO1-shha
Phenotype of all Fish created by or utilizing MO1-shha
Phenotype Fish Conditions Figures
pancreas primordium ab2-isl labeling decreased amount, abnormal AB + MO1-shha standard conditions Fig. 5 with image from Yang et al., 2021
midbrain hindbrain boundary present, ameliorated AB + MO1-shha chemical treatment: ethanol, chemical treatment: retinoic acid Fig. 1 from Zhang et al., 2015
swimming behavior process quality, abnormal AB + MO1-shha chemical treatment by environment: ethanol Fig. 4Fig. 5 from Burton et al., 2017
swimming behavior disrupted, abnormal AB + MO1-shha chemical treatment by environment: ethanol Fig. 7Fig. 8 from Boa-Amponsem et al., 2020
midbrain hindbrain boundary absent, abnormal AB + MO1-shha chemical treatment: ethanol Fig. 1 from Zhang et al., 2015
hindbrain pax6a expression decreased amount, abnormal AB + MO1-shha standard conditions Fig. 2 from Zhang et al., 2017
pancreas primordium Ab8-ins labeling decreased amount, abnormal AB + MO1-shha standard conditions Fig. 5 with image from Yang et al., 2021
eye decreased size, abnormal AB + MO1-shha chemical treatment by environment: ethanol Fig. 2Fig. 3 from Boa-Amponsem et al., 2020
endoderm glis3 expression absent, abnormal AB + MO1-shha control Fig. 5 from Rurale et al., 2019
forebrain pax6a expression decreased amount, abnormal AB + MO1-shha standard conditions Fig. 2 from Zhang et al., 2017
eye decreased size, abnormal AB + MO1-shha chemical treatment: ethanol Fig. 6 from Zhang et al., 2015
midbrain hindbrain boundary morphology, abnormal AB + MO1-shha standard conditions Fig. 5 from Zhang et al., 2017
eye decreased size, abnormal AB + MO1-shha chemical treatment: ethanol, chemical treatment: retinoic acid Fig. 6 from Zhang et al., 2015
brain glis3 expression absent, abnormal AB + MO1-shha control Fig. 5 from Rurale et al., 2019
eye pax6a expression decreased amount, abnormal AB + MO1-shha standard conditions Fig. 2 from Zhang et al., 2017
midbrain hindbrain boundary malformed, abnormal AB + MO1-shha chemical treatment by environment: ethanol Fig. 2 from Burton et al., 2017
eye decreased size, abnormal AB + MO1-shha chemical treatment by environment: ethanol Fig. 3 from Burton et al., 2017
slow muscle cell nucleus decreased amount, abnormal WT + MO1-shha standard conditions Fig. 6 from Philipp et al., 2008
whole organism lacks all parts of type ceratobranchial 5 tooth, abnormal WT + MO1-shha standard conditions Fig. 3 with image from Jackman et al., 2010
somite muscle pioneer decreased amount, abnormal WT + MO1-shha standard conditions Fig. 6 from Philipp et al., 2008
odontogenesis arrested, abnormal WT + MO1-shha standard conditions Fig. 3 with image from Jackman et al., 2010
midbrain-hindbrain boundary development process quality, abnormal WT + MO1-shha chemical treatment: ethanol Fig. 10Fig. S1 from Zhang et al., 2014
eye decreased size, abnormal WT + MO1-shha chemical treatment: ethanol Fig. S1 from Zhang et al., 2014
pancreas primordium Ab8-ins labeling amount, ameliorated cq109Tg/cq109Tg + MO1-shha standard conditions Fig. 5 with image from Yang et al., 2021
pancreas primordium ab2-isl labeling amount, ameliorated cq109Tg/cq109Tg + MO1-shha standard conditions Fig. 5 with image from Yang et al., 2021
midbrain hindbrain boundary absent, abnormal AB + MO1-aldh1a3 + MO1-shha control Fig. 1 from Zhang et al., 2015
midbrain hindbrain boundary present, ameliorated AB + MO1-aldh1a3 + MO1-shha chemical treatment: retinoic acid Fig. 1 from Zhang et al., 2015
pancreas primordium Ab8-ins labeling amount, ameliorated AB + MO1-shha + MO2-gmnn standard conditions Fig. 5 with image from Yang et al., 2021
pancreas primordium ab2-isl labeling amount, ameliorated AB + MO1-shha + MO2-gmnn standard conditions Fig. 5 with image from Yang et al., 2021
slow muscle cell nucleus decreased amount, abnormal WT + MO1-grk3 + MO1-shha standard conditions Fig. 6 from Philipp et al., 2008
somite muscle pioneer decreased amount, abnormal WT + MO1-grk3 + MO1-shha standard conditions Fig. 6 from Philipp et al., 2008
odontogenesis delayed, abnormal WT + MO1-shha + MO2-shhb standard conditions Fig. 3 with image from Jackman et al., 2010
tooth placode position, abnormal WT + MO1-shha + MO2-shhb standard conditions Fig. 3 with image from Jackman et al., 2010
Citations