Morpholino
MO1-shha
- ID
- ZDB-MRPHLNO-050204-6
- Name
- MO1-shha
- Previous Names
- Target
- Sequence
-
5' - CAGCACTCTCGTCAAAAGCCGCATT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
A translation blocking morpholino against shh. Embryos have a normal head and u-shaped somites. The myoseptum is absent. The finbuds are reduced compared with wild type embryos.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-shha
No data available
Phenotype
Phenotype resulting from MO1-shha
1 - 5 of 12 Show all
Phenotype of all Fish created by or utilizing MO1-shha
1 - 5 of 33 Show all
Citations
- Heng, J., Shi, B., Zhou, J.Y., Zhang, Y., Ma, D., Yang, Y.G., Liu, F. (2023) Cpeb1b-mediated cytoplasmic polyadenylation of shha mRNA modulates zebrafish definitive hematopoiesis. Proceedings of the National Academy of Sciences of the United States of America. 120:e2212212120e2212212120
- Yang, Y., Wang, H., He, J., Shi, W., Jiang, Z., Gao, L., Jiang, Y., Ni, R., Yang, Q., Luo, L. (2021) A single-cell-resolution fate map of endoderm reveals demarcation of pancreatic progenitors by cell cycle. Proceedings of the National Academy of Sciences of the United States of America. 118(25):
- Boa-Amponsem, O., Zhang, C., Burton, D., Williams, K.P., Cole, G.J. (2020) Ethanol and cannabinoids regulate zebrafish GABAergic neuron development and behavior in a sonic hedgehog and fibroblast growth factor dependent mechanism. Alcoholism, clinical and experimental research. 44(7):1366-1377
- Rurale, G., Marelli, F., Duminuco, P., Persani, L. (2019) Glis3 as a critical regulator of thyroid primordium specification. Thyroid : official journal of the American Thyroid Association. 30(2):277-289
- Burton, D., Zhang, C., Boa-Amponsem, O., Mackinnon, S., Cole, G.J. (2017) Long-term behavioral change as a result of acute ethanol exposure in zebrafish: Evidence for a role for sonic hedgehog but not retinoic acid signaling. Neurotoxicology and teratology. 61:66-73
- Zhang, C., Boa-Amponsem, O., Cole, G.J. (2017) Comparison of molecular marker expression in early zebrafish brain development following chronic ethanol or morpholino treatment. Experimental brain research. 235(8):2413-2423
- Wen, W., Pillai-Kastoori, L., Wilson, S.G., Morris, A.C. (2015) Sox4 regulates choroid fissure closure by limiting hedgehog signaling during ocular morphogenesis. Developmental Biology. 399(1):139-53
- Zhang, C., Anderson, A., Cole, G.J. (2015) Analysis of crosstalk between retinoic acid and sonic hedgehog pathways following ethanol exposure in embryonic zebrafish. Birth defects research. Part A, Clinical and molecular teratology. 103(12):1046-57
- Pillai-Kastoori, L., Wen, W., Wilson, S.G., Strachan, E., Lo-Castro, A., Fichera, M., Musumeci, S.A., Lehmann, O.J., Morris, A.C. (2014) Sox11 Is Required to Maintain Proper Levels of Hedgehog Signaling during Vertebrate Ocular Morphogenesis. PLoS Genetics. 10:e1004491
- Zhang, C., Frazier, J.M., Chen, H., Liu, Y., Lee, J.A., Cole, G.J. (2014) Molecular and morphological changes in zebrafish following transient ethanol exposure during defined developmental stages. Neurotoxicology and teratology. 44:70-80
1 - 10 of 22
Show