Morpholino

MO2-neurog1

ID

ZDB-MRPHLNO-050202-2

Name

MO2-neurog1

Previous Names

ngn-MO (1)

Target

neurog1 (1)

Sequence

5' - CCATATCGGAGTATACGATCTCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-neurog1

Expressed Gene	Anatomy	Figures
foxd3	dorsal root ganglion neuron glial cell	Fig. 7 from McGraw et al., 2008

Phenotype

Phenotype resulting from MO2-neurog1

Phenotype	Fish	Figures
afferent neuron neuron projection terminus decreased amount, abnormal	TU + MO2-neurog1	Fig. 2 from Sheets, 2017
dorsal root ganglion morphology, abnormal	w61Tg + MO2-neurog1	Fig. 6 from McGraw et al., 2008
posterior lateral line neuromast innervation decreased occurrence, abnormal	TU + MO2-neurog1	Fig. 2 from Sheets, 2017

Phenotype of all Fish created by or utilizing MO2-neurog1

Phenotype	Fish	Conditions	Figures
posterior lateral line neuromast hair cell amount, ameliorated	TU + MO2-neurog1	chemical treatment by environment: kainic acid, chemical treatment by environment: 6-Cyano-7-nitroquinoxaline-2,3-dione	Fig. 4 from Sheets, 2017
posterior lateral line neuromast neuromast hair cell ab5-casp3 labeling increased amount, abnormal	TU + MO2-neurog1	chemical treatment by environment: kainic acid	Fig. 7 from Sheets, 2017
posterior lateral line neuromast hair cell decreased amount, abnormal	TU + MO2-neurog1	chemical treatment by environment: kainic acid	Fig. 3 , Fig. 4 from Sheets, 2017
afferent neuron neuron projection terminus decreased amount, abnormal	TU + MO2-neurog1	control	Fig. 2 from Sheets, 2017
posterior lateral line neuromast hair cell decreased amount, abnormal	TU + MO2-neurog1	chemical treatment by environment: N-methyl-D-aspartic acid	Fig. 3 , Fig. 4 from Sheets, 2017
neuromast hair cell apoptotic body increased amount, abnormal	TU + MO2-neurog1	chemical treatment by environment: kainic acid	Fig. 7 from Sheets, 2017
posterior lateral line neuromast hair cell decreased amount, exacerbated	TU + MO2-neurog1	chemical treatment by environment: N-methyl-D-aspartic acid, chemical treatment by environment: kainic acid	Fig. 4 from Sheets, 2017
neuromast hair cell apoptotic process increased occurrence, abnormal	TU + MO2-neurog1	chemical treatment by environment: kainic acid	Fig. 7 from Sheets, 2017
posterior lateral line neuromast hair cell decreased amount, ameliorated	TU + MO2-neurog1	chemical treatment by environment: N-methyl-D-aspartic acid, chemical treatment by environment: 2-amino-5-phosphonopentanoic acid	Fig. 4 from Sheets, 2017
neuromast hair cell apoptotic body increased amount, abnormal	TU + MO2-neurog1	chemical treatment by environment: N-methyl-D-aspartic acid	Fig. 7 from Sheets, 2017
posterior lateral line neuromast neuromast hair cell ab5-casp3 labeling increased amount, abnormal	TU + MO2-neurog1	chemical treatment by environment: N-methyl-D-aspartic acid	Fig. 7 from Sheets, 2017
posterior lateral line neuromast innervation decreased occurrence, abnormal	TU + MO2-neurog1	control	Fig. 2 from Sheets, 2017
neuromast hair cell apoptotic process increased occurrence, exacerbated	TU + MO2-neurog1	chemical treatment by environment: N-methyl-D-aspartic acid, chemical treatment by environment: kainic acid	Fig. 7 from Sheets, 2017
neuromast hair cell apoptotic process increased occurrence, abnormal	TU + MO2-neurog1	chemical treatment by environment: N-methyl-D-aspartic acid	Fig. 7 from Sheets, 2017
dorsal root ganglion morphology, abnormal	w61Tg + MO2-neurog1	standard conditions	Fig. 6 from McGraw et al., 2008
hair cell GCaMP expression decreased amount, abnormal	w78Tg + MO2-neurog1	chemical treatment by environment: N-methyl-D-aspartic acid, chemical treatment by environment: Isradipine	Fig. 6 from Sheets, 2017
hair cell cytosol GCaMP expression increased amount, abnormal	w78Tg + MO2-neurog1	chemical treatment by environment: gentamycin	Fig. 6 from Sheets, 2017

Citations