Morpholino
MO1-eya1
- ID
- ZDB-MRPHLNO-050124-1
- Name
- MO1-eya1
- Previous Names
-
- eya1 MO (1)
- Target
- Sequence
-
5' - AAACAAAGATGATAGACCTACTTCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-eya1
No data available
Phenotype
Phenotype resulting from MO1-eya1
| Phenotype | Fish | Figures |
|---|---|---|
| otic vesicle malformed, abnormal | WT + MO1-eya1 |
Fig. 6
from Landgraf et al., 2010 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-eya1
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| otic vesicle malformed, abnormal | WT + MO1-eya1 | standard conditions |
Fig. 6
from Landgraf et al., 2010 |
1 - 1 of 1
Citations
- Landgraf, K., Bollig, F., Trowe, M.O., Besenbeck, B., Ebert, C., Kruspe, D., Kispert, A., Hänel, F., and Englert, C. (2010) Sipl1 and Rbck1 are novel Eya1-binding proteins with a role in craniofacial development. Molecular and cellular biology. 30(24):5764-5775
- Kozlowski, D.J., Whitfield, T.T., Hukriede, N.A., Lam, W.K., and Weinberg, E.S. (2005) The zebrafish dog-eared mutation disrupts eya1, a gene required for cell survival and differentiation in the inner ear and lateral line. Developmental Biology. 277(1):27-41
1 - 2 of 2
Show