Morpholino
MO1-twsg1b
- ID
- ZDB-MRPHLNO-050119-5
- Name
- MO1-twsg1b
- Previous Names
- Target
- Sequence
-
5' - CTGATGATGATGATGAAGACCCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-twsg1b
No data available
Phenotype
Phenotype resulting from MO1-twsg1b
1 - 5 of 11 Show all
Phenotype of all Fish created by or utilizing MO1-twsg1b
1 - 5 of 22 Show all
Citations
- Esser, J.S., Steiner, R.E., Deckler, M., Schmitt, H., Engert, B., Link, S., Charlet, A., Patterson, C., Bode, C., Zhou, Q., Moser, M. (2018) Extracellular bone morphogenetic protein modulator BMPER and twisted gastrulation homolog 1 preserve arterial venous specification in zebrafish blood vessel development and regulate Notch signaling in endothelial cells. The FEBS journal. 285(8):1419-1436
- Heinke, J., Juschkat, M., Charlet, A., Mnich, L., Helbing, T., Bode, C., Patterson, C., and Moser, M. (2013) Antagonism and synergy between extracellular BMP modulators Tsg and BMPER to balance blood vessel formation. Journal of Cell Science. 126(Pt 14):3082-94
- Xie, J., and Fisher, S. (2005) Twisted gastrulation enhances BMP signaling through chordin dependent and independent mechanisms. Development (Cambridge, England). 132(2):383-391
- Little, S.C., and Mullins, M.C. (2004) Twisted gastrulation promotes BMP signaling in zebrafish dorsal-ventral axial patterning. Development (Cambridge, England). 131(23):5825-5835
- Ross, J.J., Shimmi, O., Vilmos, P., Petryk, A., Kim, H., Gaudenz, K., Hermanson, S., Ekker, S.C., O'Connor, M.B., and Marsh, J.L. (2001) Twisted gastrulation is a conserved extracellular BMP antagonist. Nature. 410(6827):479-483
1 - 5 of 5
Show