Morpholino
MO1-tll1
- ID
- ZDB-MRPHLNO-041217-9
- Name
- MO1-tll1
- Previous Names
-
- tolloid MO (1)
- Target
- Sequence
-
5' - GCAGAGTAAAGGTAGTCCATCTGAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tll1
No data available
Phenotype
Phenotype resulting from MO1-tll1
| Phenotype | Fish | Figures |
|---|---|---|
| caudal fin aplastic, abnormal | WT + MO1-tll1 |
Fig. 1
from Lele et al., 2001 |
| post-vent region decreased length, abnormal | WT + MO1-tll1 |
Fig. 1
from Lele et al., 2001 |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-tll1
from 1 - 5 of 5
Citations
- Tuazon, F.B., Wang, X., Andrade, J.L., Umulis, D., Mullins, M.C. (2020) Proteolytic Restriction of Chordin Range Underlies BMP Gradient Formation. Cell Reports. 32:108039
- Zhang, J.L., Patterson, L.J., Qiu, L.Y., Graziussi, D., Sebald, W., and Hammerschmidt, M. (2010) Binding between Crossveinless-2 and Chordin von Willebrand factor type C domains promotes BMP signaling by blocking Chordin activity. PLoS One. 5(9):e12846
- Muraoka, O., Shimizu, T., Yabe, T., Nojima, H., Bae, Y.K., Hashimoto, H., and Hibi, M. (2006) Sizzled controls dorso-ventral polarity by repressing cleavage of the Chordin protein. Nature cell biology. 8(4):329-340
- Lele, Z., Bakkers, J., and Hammerschmidt, M. (2001) Morpholino phenocopies of the swirl, snailhouse, somitabun, minifin, silberblick, and pipetail mutations. Genesis (New York, N.Y. : 2000). 30(3):190-194
1 - 4 of 4
Show