Morpholino
MO1-bmp7a
- ID
- ZDB-MRPHLNO-041217-7
- Name
- MO1-bmp7a
- Previous Names
- Target
- Sequence
-
5' - GCACTGGAAACATTTTTAGAGTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bmp7a
No data available
Phenotype
Phenotype resulting from MO1-bmp7a
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO1-bmp7a
1 - 5 of 8 Show all
Citations
- Li, L., Ning, G., Yang, S., Yan, Y., Cao, Y., Wang, Q. (2019) BMP signaling is required for nkx2.3-positive pharyngeal pouch progenitor specification in zebrafish. PLoS Genetics. 15:e1007996
- Chuang, H.M., Su, H.L., Li, C., Lin, S.Z., Yen, S.Y., Huang, M.H., Ho, L.I., Chiou, T.W., Harn, H.J. (2016) The Role of Butylidenephthalide in Targeting the Microenvironment Which Contributes to Liver Fibrosis Amelioration. Frontiers in pharmacology. 7:112
- Wang, Y., Li, W.H., Li, Z., Liu, W., Zhou, L., Gui, J.F. (2015) BMP and RA signaling cooperate to regulate Apolipoprotein C1 expression during embryonic development. Gene. 554:196-204
- Chocron, S., Verhoeven, M.C., Rentzsch, F., Hammerschmidt, M., and Bakkers, J. (2007) Zebrafish Bmp4 regulates left-right asymmetry at two distinct developmental time points. Developmental Biology. 305(2):577-588
- von der Hardt, S., Bakkers, J., Inbal, A., Carvalho, L., Solnica-Krezel, L., Heisenberg, C.P., and Hammerschmidt, M. (2007) The Bmp Gradient of the Zebrafish Gastrula Guides Migrating Lateral Cells by Regulating Cell-Cell Adhesion. Current biology : CB. 17(6):475-487
- Lele, Z., Bakkers, J., and Hammerschmidt, M. (2001) Morpholino phenocopies of the swirl, snailhouse, somitabun, minifin, silberblick, and pipetail mutations. Genesis (New York, N.Y. : 2000). 30(3):190-194
1 - 6 of 6
Show