Morpholino

MO1-notch3

ID
ZDB-MRPHLNO-041207-7
Name
MO1-notch3
Previous Names
  • MO-notch3-1 (1)
Target
Sequence
5' - ATATCCAAAGGCTGTAATTCCCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
designed to bind to 5'-end of gene
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-notch3
Expressed Gene Anatomy Figures
elavl3 Fig. 5 from Qiu et al., 2009
foxb1a Fig. 5 from Qiu et al., 2009
foxi3a Fig. 4 with image from Hsiao et al., 2007
her4.1 Fig. 5 from Qiu et al., 2009
neurog1 Fig. 5 from Qiu et al., 2009
rfng Fig. 5 from Qiu et al., 2009
Phenotype
Phenotype resulting from MO1-notch3
No data available
Phenotype of all Fish created by or utilizing MO1-notch3
Phenotype Fish Conditions Figures
rhombomere boundary formation disrupted, abnormal notch1ath35b/th35b + MO1-notch3 standard conditions Fig. 5 from Qiu et al., 2009
neural tube morphology, abnormal notch1ath35b/th35b + MO1-notch3 standard conditions Fig. 5 from Qiu et al., 2009
hindbrain neuroepithelial cell aggregated, abnormal notch1ath35b/th35b + MO1-notch3 standard conditions Fig. 5 from Qiu et al., 2009
ectoderm development disrupted, abnormal notch1ath35b/th35b + MO1-notch3 standard conditions Fig. 4 with image from Hsiao et al., 2007
hindbrain neuron increased amount, abnormal notch1ath35b/th35b + MO1-notch3 standard conditions Fig. 5 from Qiu et al., 2009
hindbrain epithelium disorganized, abnormal notch1ath35b/th35b + MO1-notch3 standard conditions Fig. 5 from Qiu et al., 2009
hindbrain development disrupted, abnormal notch1ath35b/th35b + MO1-notch3 standard conditions Fig. 5 from Qiu et al., 2009
neural plate morphology, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 1 from Yeo et al., 2007
negative regulation of neurogenesis decreased occurrence, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
central nervous system cellular quality, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Yeo et al., 2007
Notch signaling pathway decreased occurrence, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
neurogenesis increased occurrence, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
neural plate development process quality, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 1 from Yeo et al., 2007
negative regulation of neurogenesis decreased occurrence, abnormal WT + MO1-nlk1 + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
Notch signaling pathway decreased occurrence, abnormal WT + MO1-nlk1 + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
neurogenesis increased occurrence, abnormal WT + MO1-nlk1 + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
peripheral neuron decreased length, abnormal knu2Tg + MO1-notch1a + MO1-notch3 + MO4-notch1b standard conditions Fig. 4 from So et al., 2009
dorsal aorta mural cell absent, abnormal ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2 standard conditions Fig. 3 with image from Ando et al., 2019
intersegmental vessel mural cell absent, abnormal ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2 standard conditions Fig. 3 with image from Ando et al., 2019
intersegmental vessel mural cell decreased amount, abnormal ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2 standard conditions Fig. 3 with image from Ando et al., 2019
intersegmental vessel mural cell decreased amount, exacerbated ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2 chemical treatment by environment: DAPT Fig. 3 with image from Ando et al., 2019
hyaloid vessel mural cell decreased amount, abnormal ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2 standard conditions Fig. 3 with image from Ando et al., 2019
brain vasculature mural cell absent, abnormal ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2 standard conditions Fig. 3 with image from Ando et al., 2019
brain vasculature pericyte decreased amount, abnormal ncv1Tg; ncv34Tg; nkuasgfp1aTg + MO1-notch3 + MO2-notch2 standard conditions Fig. 3 with image from Ando et al., 2019
brain vasculature pericyte absent, abnormal ncv1Tg; ncv34Tg; nkuasgfp1aTg + MO1-notch3 + MO2-notch2 standard conditions Fig. 3 with image from Ando et al., 2019
dorsal aorta vascular associated smooth muscle cell decreased amount, abnormal s843Tg; uto5Tg + MO1-notch3 + MO2-notch1b control Fig. 3 with image from Chen et al., 2017
dorsal aorta anatomical region mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-notch3 + MO2-notch1b control Fig. 3 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-notch3 + MO2-notch1b control Fig. 3 with image from Chen et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.