Morpholino
MO1-notch1b
- ID
- ZDB-MRPHLNO-041207-5
- Name
- MO1-notch1b
- Previous Names
-
- MO-notch1b-1 (1)
- Target
- Sequence
-
5' - CTCTCCCCATTCATTCTGGTTGTCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This morpholino may hybridize only to exon sequence in the middle of notch1b.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-notch1b
No data available
Phenotype
Phenotype resulting from MO1-notch1b
No data available
Phenotype of all Fish created by or utilizing MO1-notch1b
1 - 3 of 3
Citations
- Münch, J., González-Rajal, A., and de la Pompa, J.L. (2013) Notch regulates blastema proliferation and prevents differentiation during adult zebrafish fin regeneration. Development (Cambridge, England). 140(7):1402-1411
- Hsiao, C.D., You, M.S., Guh, Y.J., Ma, M., Jiang, Y.J., and Hwang, P.P. (2007) A Positive Regulatory Loop between foxi3a and foxi3b Is Essential for Specification and Differentiation of Zebrafish Epidermal Ionocytes. PLoS One. 2(1):e302
- Lorent, K., Yeo, S.Y., Oda, T., Chandrasekharappa, S., Chitnis, A., Matthews, R.P., and Pack, M. (2004) Inhibition of Jagged-mediated Notch signaling disrupts zebrafish biliary development and generates multi-organ defects compatible with an Alagille syndrome phenocopy. Development (Cambridge, England). 131(22):5753-5766
1 - 3 of 3
Show