Morpholino
MO1-jag1a
- ID
- ZDB-MRPHLNO-041207-1
- Name
- MO1-jag1a
- Previous Names
-
- MO-jag1a-1 (1)
- Target
- Sequence
-
5' - CGGTTTGTCTGTCTGTGTGTCTGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
designed to bind to 5' end of gene
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-jag1a
No data available
Phenotype
Phenotype resulting from MO1-jag1a
No data available
Phenotype of all Fish created by or utilizing MO1-jag1a
from 1 - 4 of 4
Citations
- Lu, Y.F., Liu, D.W., Li, I.C., Lin, J., Wang, C.M., Chu, K.C., Kuo, H.H., Lin, C.Y., Yih, L.H., Jiang, Y.J., Hwang, S.L. (2021) Delta/Jagged-mediated Notch signaling induces the differentiation of agr2-positive epidermal mucous cells in zebrafish embryos. PLoS Genetics. 17:e1009969
- Bill, B.R., Balciunas, D., McCarra, J.A., Young, E.D., Xiong, T., Spahn, A.M., Garcia-Lecea, M., Korzh, V., Ekker, S.C., and Schimmenti, L.A. (2008) Development and notch signaling requirements of the zebrafish choroid plexus. PLoS One. 3(9):e3114
- Jänicke, M., Carney, T.J., and Hammerschmidt, M. (2007) Foxi3 transcription factors and Notch signaling control the formation of skin ionocytes from epidermal precursors of the zebrafish embryo. Developmental Biology. 307(2):258-271
- Lorent, K., Yeo, S.Y., Oda, T., Chandrasekharappa, S., Chitnis, A., Matthews, R.P., and Pack, M. (2004) Inhibition of Jagged-mediated Notch signaling disrupts zebrafish biliary development and generates multi-organ defects compatible with an Alagille syndrome phenocopy. Development (Cambridge, England). 131(22):5753-5766
1 - 4 of 4
Show