Morpholino
MO1-apc
- ID
- ZDB-MRPHLNO-041206-2
- Name
- MO1-apc
- Previous Names
-
- apc-MO-1 (1)
- Target
- Sequence
-
5' - TAGCATACTCTACCTGTGCTCTTCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-apc
No data available
Phenotype
Phenotype resulting from MO1-apc
No data available
Phenotype of all Fish created by or utilizing MO1-apc
No data available
Citations
- Akieda, Y., Ogamino, S., Furuie, H., Ishitani, S., Akiyoshi, R., Nogami, J., Masuda, T., Shimizu, N., Ohkawa, Y., Ishitani, T. (2019) Cell competition corrects noisy Wnt morphogen gradients to achieve robust patterning in the zebrafish embryo. Nature communications. 10:4710
- Pestel, J., Ramadass, R., Gauvrit, S., Helker, C., Herzog, W., Stainier, D.Y. (2016) Real-time 3D visualization of cellular rearrangements during cardiac valve formation. Development (Cambridge, England). 143:2217-27
- Faro, A., Boj, S.F., Ambrósio, R., van den Broek, O., Korving, J., and Clevers, H. (2009) T-Cell Factor 4 (tcf7l2) Is the Main Effector of Wnt Signaling During Zebrafish Intestine Organogenesis. Zebrafish. 6(1):59-68
- Lin, X., and Xu, X. (2009) Distinct functions of Wnt/{beta}-catenin signaling in KV development and cardiac asymmetry. Development (Cambridge, England). 136(2):207-217
- Phelps, R.A., Chidester, S., Dehghanizadeh, S., Phelps, J., Sandoval, I.T., Rai, K., Broadbent, T., Sarkar, S., Burt, R.W., and Jones, D.A. (2009) A two-step model for colon adenoma initiation and progression caused by APC loss. Cell. 137(4):623-634
- Eisinger, A.L., Nadauld, L.D., Shelton, D.N., Prescott, S.M., Stafforini, D.M., and Jones, D.A. (2007) Retinoic Acid Inhibits β-Catenin through Suppression of Cox-2: A role for truncated adenomatous polyposis coli. The Journal of biological chemistry. 282(40):29394-29400
- Eisinger, A.L., Nadauld, L.D., Shelton, D.N., Peterson, P.W., Phelps, R.A., Chidester, S., Stafforini, D.M., Prescott, S.M., and Jones, D.A. (2006) The adenomatous polyposis coli tumor suppressor gene regulates expression of cyclooxygenase-2 by a mechanism that involves retinoic Acid. The Journal of biological chemistry. 281(29):20474-20482
- Shelton, D.N., Sandoval, I.T., Eisinger, A., Chidester, S., Ratnayake, A., Ireland , C.M., and Jones, D.A. (2006) Up-regulation of CYP26A1 in Adenomatous Polyposis Coli-Deficient Vertebrates via a WNT-Dependent Mechanism: Implications for Intestinal Cell Differentiation and Colon Tumor Development. Cancer research. 66(15):7571-7577
- Nadauld, L.D., Sandoval, I.T., Chidester, S., Yost, H.J., and Jones, D.A. (2004) Adenomatous polyposis coli control of retinoic acid biosynthesis is critical for zebrafish intestinal development and differentiation. The Journal of biological chemistry. 279(49):51581-51589
1 - 9 of 9
Show