Morpholino
MO1-fgf8a
- ID
- ZDB-MRPHLNO-041109-5
- Name
- MO1-fgf8a
- Previous Names
- Target
- Sequence
-
5' - TAGGATGCTCTTACCATGAACGTCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fgf8a
No data available
Phenotype
Phenotype resulting from MO1-fgf8a
1 - 5 of 12 Show all
Phenotype of all Fish created by or utilizing MO1-fgf8a
1 - 5 of 16 Show all
Citations
- Zhang, C., Boa-Amponsem, O., Cole, G.J. (2017) Comparison of molecular marker expression in early zebrafish brain development following chronic ethanol or morpholino treatment. Experimental brain research. 235(8):2413-2423
- McCarthy, N., Sidik, A., Bertrand, J.Y., Eberhart, J.K. (2016) An Fgf-Shh signaling hierarchy regulates early specification of the zebrafish skull. Developmental Biology. 415(2):261-77
- Maulding, K., Padanad, M.S., Dong, J., Riley, B.B. (2014) Mesodermal Fgf10b cooperates with other Fgfs during induction of otic and epibranchial placodes in zebrafish. Developmental Dynamics : an official publication of the American Association of Anatomists. 243(10):1275-85
- Su, C.Y., Kemp, H.A., and Moens, C.B. (2014) Cerebellar development in the absence of Gbx function in zebrafish. Developmental Biology. 386(1):181-90
- Shimozono, S., Iimura, T., Kitaguchi, T., Higashijima, S.I., and Miyawaki, A. (2013) Visualization of an endogenous retinoic acid gradient across embryonic development. Nature. 496(7445):363-6
- Sorrell, M.R., and Waxman, J.S. (2011) Restraint of Fgf8 signaling by retinoic acid signaling is required for proper heart and forelimb formation. Developmental Biology. 358(1):44-55
- Hong, S.K., and Dawid, I.B. (2009) FGF-dependent left-right asymmetry patterning in zebrafish is mediated by Ier2 and Fibp1. Proceedings of the National Academy of Sciences of the United States of America. 106(7):2230-2235
- Neugebauer, J.M., Amack, J.D., Peterson, A.G., Bisgrove, B.W., and Yost, H.J. (2009) FGF signalling during embryo development regulates cilia length in diverse epithelia. Nature. 458(7238):651-654
- Nechiporuk, A., Linbo, T., Poss, K.D., and Raible, D.W. (2007) Specification of epibranchial placodes in zebrafish. Development (Cambridge, England). 134(3):611-623
- Nechiporuk, A., Linbo, T., and Raible, D.W. (2005) Endoderm-derived Fgf3 is necessary and sufficient for inducing neurogenesis in the epibranchial placodes in zebrafish. Development (Cambridge, England). 132(16):3717-3730
1 - 10 of 15
Show