Morpholino
MO3-fgf3
- ID
- ZDB-MRPHLNO-041109-3
- Name
- MO3-fgf3
- Previous Names
-
- fgf3C-MO
- Target
- Sequence
-
5' - TCTCGCTGGAATAGAAAGAGCTGGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-fgf3
No data available
Phenotype
Phenotype resulting from MO3-fgf3
No data available
Phenotype of all Fish created by or utilizing MO3-fgf3
1 - 3 of 3
Citations
- McCarthy, N., Sidik, A., Bertrand, J.Y., Eberhart, J.K. (2016) An Fgf-Shh signaling hierarchy regulates early specification of the zebrafish skull. Developmental Biology. 415(2):261-77
- McMahon, C., Gestri, G., Wilson, S.W., and Link, B.A. (2009) Lmx1b is essential for survival of periocular mesenchymal cells and influences Fgf-mediated retinal patterning in zebrafish. Developmental Biology. 332(2):287-298
- Crump, J.G., Maves, L., Lawson, N.D., Weinstein, B.M., and Kimmel, C.B. (2004) An essential role for Fgfs in endodermal pouch formation influences later craniofacial skeletal patterning. Development (Cambridge, England). 131(22):5703-5716
- Hans, S., Liu, D., and Westerfield, M. (2004) Pax8 and Pax2a function synergistically in otic specification, downstream of the Foxi1 and Dlx3b transcription factors. Development (Cambridge, England). 131(20):5091-5102
- Jackman, W.R., Draper, B.W., and Stock, D.W. (2004) Fgf signaling is required for zebrafish tooth development. Developmental Biology. 274(1):139-157
- Liu, D., Chu, H., Maves, L., Yan, Y.-L., Morcos, P.A., Postlethwait, J.H., and Westerfield, M. (2003) Fgf3 and Fgf8 dependent and independent transcription factors are required for otic placode specification. Development (Cambridge, England). 130(10):2213-2224
- Maves, L., Jackman, W., and Kimmel, C.B. (2002) FGF3 and FGF8 mediate a rhombomere 4 signaling activity in the zebrafish hindbrain. Development (Cambridge, England). 129:3825-3837
1 - 7 of 7
Show