miRNA Gene

dre-let-7b

ID
ZDB-MIRNAG-081203-3
Name
microRNA let7b
Symbol
dre-let-7b Nomenclature History
Previous Names
  • miR-let7b (1)
  • mirlet-7b (1)
  • mirlet7b
  • miRlet7b (1)
  • mirnlet7b (1)
Type
miRNA_gene
Location
Chr: 4 Mapping Details/Browsers
Description
Acts upstream of or within regulation of miRNA-mediated gene silencing.
Genome Resources
Note
UGAGGUAGUAGGUUGUGUGGUU
Comparative Information
Expression
All Expression Data
3 figures from 3 publications
Cross-Species Comparison
High Throughput Data
Thisse Expression Data
No data available
Wild Type Expression Summary
Phenotype
All Phenotype Data
No data available
Cross-Species Comparison
Alliance
Phenotype Summary
Mutations
Mutants
Sequence Targeting Reagents
Human Disease
Associated With dre-let-7b Human Ortholog
No data available
Associated With dre-let-7b Via Experimental Models
No data available
Gene Ontology
Protein Domains
Domain, Family, and Site Summary
No data available
Domain Details Per Protein
No data available
Transcripts
Genome Browsers
No data available
Type Name Length (nt) Analysis
miRNA mirlet7b-001 (1) 22 nt
Interactions and Pathways
No data available
Antibodies
No data available
Plasmids
No data available
Constructs
Marker Relationships
Sequences
Orthology
Comparative Orthology
Alliance
Gene Tree
Ensembl
Citations