ZFIN is now using GRCz12tu for Genomic Data
miRNA Gene
mir196a-1
- ID
- ZDB-MIRNAG-041217-14
- Name
- microRNA 196a-1
- Symbol
- mir196a-1 Nomenclature History
- Previous Names
- Type
- miRNA_gene
- Location
- Chr: 23 Mapping Details/Browsers
- Genome Assembly
- GRCz12tu
- Annotation Status
- Current
- Description
- Predicted to enable mRNA regulatory element binding translation repressor activity. Acts upstream of or within miRNA-mediated post-transcriptional gene silencing and pectoral fin development. Is expressed in central nervous system; neural tube; pronephric duct; and tail bud. Human ortholog(s) of this gene implicated in hepatocellular carcinoma. Orthologous to human MIR196A2 (microRNA 196a-2).
- Genome Resources
- Note
-
Predicted Stem-Loop Sequence:
5' - GGCUGGUGCGUGGUUUAGGUAGUUUCAUGUUGUUGGGAUUGGCUUCCUGGCUCGACAACAAGAAACUGCCUUGAUUACGUCAGUUCGUC - 3' (1) - Comparative Information
-
- All Expression Data
- 2 figures from 2 publications
- Cross-Species Comparison
- High Throughput Data
- Thisse Expression Data
- No data available
Wild Type Expression Summary
- All Phenotype Data
- No data available
- Cross-Species Comparison
- Alliance
Phenotype Summary
Mutations
No data available
Human Disease
Domain, Family, and Site Summary
No data available
Domain Details Per Protein
No data available
- Genome Browsers
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| mRNA |
mir196a-1-201
(1)
|
Ensembl | 106 nt | ||
| miRNA | mir196a-001 (1) | 22 nt |
1 - 2 of 2
Interactions and Pathways
No data available
Plasmids
No data available
No data available
| Relationship | Marker Type | Marker | Citations |
|---|---|---|---|
| Contained in | BAC | DKEY-81P22 |
1 - 1 of 1
Show
- Genome Browsers
| Type | Accession # | Genome Assembly | Length (nt/aa) | Analysis |
|---|---|---|---|---|
| RNA | RefSeq:NR_034183 (1) | GRCz12tu | 106 nt | |
| Genomic | GenBank:BX005254 (1) | 160012 nt |
- Zhang, X., Li, Y., Zhang, Y., Li, S. (2021) Characterization of small RNAs in early zebrafish PGCs. Acta biochimica et biophysica Sinica. 53(4):514-516
- Desvignes, T., Batzel, P., Sydes, J., Eames, B.F., Postlethwait, J.H. (2019) miRNA analysis with Prost! reveals evolutionary conservation of organ-enriched expression and post-transcriptional modifications in three-spined stickleback and zebrafish. Scientific Reports. 9:3913
- King, B.L., Yin, V.P. (2016) A Conserved MicroRNA Regulatory Circuit Is Differentially Controlled during Limb/Appendage Regeneration. PLoS One. 11:e0157106
- Desvignes, T., Beam, M.J., Batzel, P., Sydes, J., Postlethwait, J.H. (2014) Expanding the annotation of zebrafish microRNAs based on small RNA sequencing. Gene. 546(2):386-9
- He, X., Yan, Y.L., Delaurier, A., and Postlethwait, J.H. (2011) Observation of miRNA Gene Expression in Zebrafish Embryos by In Situ Hybridization to MicroRNA Primary Transcripts. Zebrafish. 8(1):1-8
- He, X., Yan, Y.L., Eberhart, J.K., Herpin, A., Wagner, T.U., Schartl, M., and Postlethwait, J.H. (2011) miR-196 regulates axial patterning and pectoral appendage initiation. Developmental Biology. 357(2):463-77
- Yekta, S., Shih, I.H., and Bartel, D.P. (2004) MicroRNA-directed cleavage of HOXB8 mRNA. Science (New York, N.Y.). 304(5670):594-596
- Lim, L.P., Glasner, M.E., Yekta, S., Burge, C.B., and Bartel, D.P. (2003) Vertebrate microRNA genes. Science (New York, N.Y.). 2999(5612):1540
1 - 8 of 8
Show