EST

bc075918

ID
ZDB-EST-080403-82
Name
bc075918
Symbol
bc075918
Previous Names
None
Type
EST
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
unknown
Digest
Insert Size
939
Cloning Site
EcoRI
Vector Type
Plasmid
Vector
pCRII-Topo
Polymerase
T3 RNA polymerase
PCR Amplification
5' GTTTTCCCAGTCACGACGTTG 3'
5' GGATCCATTAACCCTCACTAAAGGGAAGACAGGAAACAGCTATGACC 3'
Quality
( Nice strong expression pattern )
Protocol
Thisse in situ hybridization protocol
Note
Data published in: Bertrand S, Thisse B, Tavares R, Sachs L, Chaumot A, Bardet PL, EscrivĂ  H, Duffraisse M, Marchand O, Safi R, Thisse C, Laudet V. Unexpected Novel Relational Links Uncovered by Extensive Developmental Profiling of Nuclear Receptor Expression. PLoS Genet. 2007 Nov 9;3(11):e188.
Gene Expression
Directly Submitted Expression Data
6 figures (16 images) from Thisse et al., 2008 [bc075918]
Marker Relationships
Sequences
Citations