EST

dq017641

ID
ZDB-EST-080403-67
Name
dq017641
Symbol
dq017641
Previous Names
None
Type
EST
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
unknown
Digest
Insert Size
700
Cloning Site
EcoRI
Vector Type
Plasmid
Vector
pBS-IISK
Polymerase
T3 RNA polymerase
PCR Amplification
5' AACAGCTATGACCATGATTAC 3'
5' GTA AAA CGA CGG CCA GT 3'
Protocol
Thisse in situ hybridization protocol
Note
Data published in: Bertrand S, Thisse B, Tavares R, Sachs L, Chaumot A, Bardet PL, EscrivĂ  H, Duffraisse M, Marchand O, Safi R, Thisse C, Laudet V. Unexpected Novel Relational Links Uncovered by Extensive Developmental Profiling of Nuclear Receptor Expression. PLoS Genet. 2007 Nov 9;3(11):e188.
Gene Expression
Directly Submitted Expression Data
7 figures (7 images) from Thisse et al., 2008 [dq017641]
Marker Relationships
Sequences
Citations