EST

u29941

ID
ZDB-EST-080403-32
Name
u29941
Symbol
u29941
Previous Names
None
Type
EST
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
unknown
Digest
Insert Size
1000
Cloning Site
SpeI - XhoI
Vector Type
Plasmid
Vector
pBS-IIKS
Polymerase
T3 RNA polymerase
PCR Amplification
5' AACAGCTATGACCATGATTAC 3'
5' GTA AAA CGA CGG CCA GT 3'
Protocol
Thisse in situ hybridization protocol
Note
Data published in: Bertrand S, Thisse B, Tavares R, Sachs L, Chaumot A, Bardet PL, EscrivĂ  H, Duffraisse M, Marchand O, Safi R, Thisse C, Laudet V. Unexpected Novel Relational Links Uncovered by Extensive Developmental Profiling of Nuclear Receptor Expression. PLoS Genet. 2007 Nov 9;3(11):e188.
Gene Expression
Directly Submitted Expression Data
7 figures (7 images) from Thisse et al., 2008 [u29941]
High Throughput Expression
GEO (1)
Marker Relationships
Sequences
Citations