CRISPR

CRISPR5-aip

ID

ZDB-CRISPR-260513-1

Name

CRISPR5-aip

Previous Names

None

Target

aip (1)

Sequence

5' - GGTTACCACTATGAAAGAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
wh86	aip

Expression

Gene expression in Wild Types + CRISPR5-aip

No data available

Phenotype

Phenotype resulting from CRISPR5-aip

No data available

Phenotype of all Fish created by or utilizing CRISPR5-aip

Phenotype	Fish	Conditions	Figures
cellular response to stress increased occurrence, abnormal	aip^wh86/wh86	standard conditions	FIGURE 6 from Perone et al., 2026
regulation of response to oxidative stress increased occurrence, abnormal	aip^wh86/wh86	standard conditions	FIGURE 6 from Perone et al., 2026
cellular response to nutrient increased occurrence, abnormal	aip^wh86/wh86	standard conditions	FIGURE 6 from Perone et al., 2026
lipid metabolic process increased occurrence, abnormal	aip^wh86/wh86	standard conditions	FIGURE 6 from Perone et al., 2026
regulation of cell division decreased occurrence, abnormal	aip^wh86/wh86	standard conditions	FIGURE 6 from Perone et al., 2026
whole organism aip expression decreased amount, abnormal	aip^wh86/wh86	standard conditions	FIGURE 5 from Perone et al., 2026
gene expression decreased process quality, abnormal	aip^wh86/wh86	standard conditions	FIGURE 9 , FIGURE 10 from Perone et al., 2026
amino acid metabolic process increased occurrence, abnormal	aip^wh86/wh86	standard conditions	FIGURE 6 from Perone et al., 2026
xenobiotic metabolic process increased occurrence, abnormal	aip^wh86/wh86	standard conditions	FIGURE 6 from Perone et al., 2026
response to 2,3,7,8-tetrachlorodibenzodioxine decreased process quality, abnormal	aip^wh86/wh86 (TL)	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4. from Karchner et al., 2026
whole organism morphology, ameliorated	aip^wh86/wh86 (TL)	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4. from Karchner et al., 2026
yolk composition, ameliorated	aip^wh86/wh86 (TL)	chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl	Fig. 4. from Karchner et al., 2026
pericardium composition, ameliorated	aip^wh86/wh86 (TL)	chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl	Fig. 4. from Karchner et al., 2026
whole organism dead, abnormal	aip^wh86/wh86 (TL)	standard conditions	Fig. 3. from Karchner et al., 2026
whole organism viability, abnormal	aip^wh86/wh86 (TL)	standard conditions	Fig. 3. from Karchner et al., 2026
whole organism aip expression decreased amount, abnormal	aip^wh86/+	standard conditions	FIGURE 5 from Perone et al., 2026
pericardium edematous, abnormal	aip^wh86/+ (TL)	chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl	Fig. 4. from Karchner et al., 2026
yolk edematous, abnormal	aip^wh86/+ (TL)	chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl	Fig. 4. from Karchner et al., 2026
whole organism morphology, abnormal	aip^wh86/+ (TL)	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4. from Karchner et al., 2026

Citations