CRISPR

CRISPR1-snapin

ID

ZDB-CRISPR-251118-1

Name

CRISPR1-snapin

Previous Names

None

Target

snapin (1)

Sequence

5' - GGATCAATGAACACCAGAAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
nu207	snapin
nu208	snapin

Expression

Gene expression in Wild Types + CRISPR1-snapin

No data available

Phenotype

Phenotype resulting from CRISPR1-snapin

Phenotype	Fish	Figures
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal	zf195Tg + CRISPR1-snapin	Fig. 3 from Yousaf et al., 2025
cerebellum decreased area, abnormal	WT + CRISPR1-snapin	Fig. 3 from Yousaf et al., 2025
cerebellum ab1-tuba labeling decreased distribution, abnormal	WT + CRISPR1-snapin	Fig. 3 from Yousaf et al., 2025
head decreased size, abnormal	WT + CRISPR1-snapin	Fig. 3 from Yousaf et al., 2025
head apoptotic process increased process quality, abnormal	WT + CRISPR1-snapin	Fig. 3 from Yousaf et al., 2025
intertectal commissure neuron decreased amount, abnormal	WT + CRISPR1-snapin	Fig. 3 from Yousaf et al., 2025
intertectal commissure neuron ab1-tuba labeling decreased distribution, abnormal	WT + CRISPR1-snapin	Fig. 3 from Yousaf et al., 2025
optic tectum decreased area, abnormal	WT + CRISPR1-snapin	Fig. 3 from Yousaf et al., 2025
optic tectum ab1-tuba labeling decreased distribution, abnormal	WT + CRISPR1-snapin	Fig. 3 from Yousaf et al., 2025

Phenotype of all Fish created by or utilizing CRISPR1-snapin

Phenotype	Fish	Conditions	Figures
whole organism viability, abnormal	snapin^nu207/nu207	standard conditions	Fig. 4 from Yousaf et al., 2025
head ab3-map1lc3b labeling increased amount, abnormal	snapin^nu207/nu207	standard conditions	Fig. 5 from Yousaf et al., 2025
fourth ventricle increased volume, abnormal	snapin^nu207/nu207	standard conditions	Fig. 4 from Yousaf et al., 2025
whole organism decreased length, abnormal	snapin^nu207/nu207	standard conditions	Fig. 4 from Yousaf et al., 2025
head decreased area, abnormal	snapin^nu207/nu207	standard conditions	Fig. 4 from Yousaf et al., 2025
granular layer corpus cerebelli cell decreased amount, abnormal	snapin^nu207/nu207	standard conditions	Fig. 4 from Yousaf et al., 2025
cerebellum posterior side decreased thickness, abnormal	snapin^nu207/nu207	standard conditions	Fig. 4 from Yousaf et al., 2025
optic tectum vacuole increased amount, abnormal	snapin^nu207/nu207	standard conditions	Fig. 5 from Yousaf et al., 2025
head ab3-map1lc3b labeling increased amount, abnormal	snapin^nu208/nu208	control	Fig. 5 from Yousaf et al., 2025
head ab3-map1lc3b labeling increased amount, abnormal	snapin^nu208/nu208	chemical treatment by environment: bafilomycin A1	Fig. 5 from Yousaf et al., 2025
whole organism dead, abnormal	snapin^nu208/nu208	standard conditions	Fig. 4 from Yousaf et al., 2025
whole organism viability, abnormal	snapin^nu208/nu208	standard conditions	Fig. 4 from Yousaf et al., 2025
head apoptotic process increased process quality, abnormal	WT + CRISPR1-snapin	control	Fig. 3 from Yousaf et al., 2025
intertectal commissure neuron decreased amount, abnormal	WT + CRISPR1-snapin	control	Fig. 3 from Yousaf et al., 2025
optic tectum decreased area, abnormal	WT + CRISPR1-snapin	control	Fig. 3 from Yousaf et al., 2025
cerebellum decreased area, abnormal	WT + CRISPR1-snapin	control	Fig. 3 from Yousaf et al., 2025
optic tectum ab1-tuba labeling decreased distribution, abnormal	WT + CRISPR1-snapin	control	Fig. 3 from Yousaf et al., 2025
cerebellum ab1-tuba labeling decreased distribution, abnormal	WT + CRISPR1-snapin	control	Fig. 3 from Yousaf et al., 2025
intertectal commissure neuron ab1-tuba labeling decreased distribution, abnormal	WT + CRISPR1-snapin	control	Fig. 3 from Yousaf et al., 2025
head decreased size, abnormal	WT + CRISPR1-snapin	control	Fig. 3 from Yousaf et al., 2025
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal	zf195Tg + CRISPR1-snapin	control	Fig. 3 from Yousaf et al., 2025

Citations