CRISPR

CRISPR3-psmd6

ID
ZDB-CRISPR-251024-45
Name
CRISPR3-psmd6
Previous Names
None
Target
Sequence
5' - GGGAAGGCGGTGACTGGGAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two "G"s were added.
Genome Resources
None
Target Location
View all 4 target locations
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
scm40 psmd6
Expression
Gene expression in Wild Types + CRISPR3-psmd6
No data available
Phenotype
Phenotype resulting from CRISPR3-psmd6
No data available
Phenotype of all Fish created by or utilizing CRISPR3-psmd6
Phenotype Fish Conditions Figures
heart looping process quality, abnormal twu34Tg + CRISPR1-psmd6 + CRISPR2-psmd6 + CRISPR3-psmd6 + CRISPR4-psmd6 standard conditions Fig 3 with image from Farr et al., 2025
atrium mislocalised ventrally, abnormal twu34Tg + CRISPR1-psmd6 + CRISPR2-psmd6 + CRISPR3-psmd6 + CRISPR4-psmd6 standard conditions Fig 3 with image from Farr et al., 2025
cardiac ventricle mislocalised anteriorly, abnormal twu34Tg + CRISPR1-psmd6 + CRISPR2-psmd6 + CRISPR3-psmd6 + CRISPR4-psmd6 standard conditions Fig 3 with image from Farr et al., 2025
trabecular layer cardiac muscle cell circular, abnormal psmd6scm40/scm40; twu34Tg standard conditions Fig 6 with image from Farr et al., 2025
heart looping process quality, abnormal psmd6scm40/scm40; twu34Tg standard conditions Fig 4 with image from Farr et al., 2025
heart contraction decreased rate, abnormal psmd6scm40/scm40; twu34Tg standard conditions Fig 7 with image from Farr et al., 2025
whole organism pomp expression increased amount, abnormal psmd6scm40/scm40; twu34Tg standard conditions Fig 4 with image from Farr et al., 2025
heart decreased functionality, abnormal psmd6scm40/scm40; twu34Tg standard conditions Fig 7 with image from Farr et al., 2025
heart morphology, abnormal psmd6scm40/scm40; twu34Tg standard conditions Fig 4 with image from Farr et al., 2025
blood accumulation head, abnormal psmd6scm40/scm40; twu34Tg standard conditions Fig 4 with image from Farr et al., 2025
whole organism dead, abnormal psmd6scm40/scm40; twu34Tg standard conditions Fig 4 with image from Farr et al., 2025
bulbus arteriosus decreased size, abnormal psmd6scm40/scm40; twu34Tg standard conditions Fig 9 with image from Farr et al., 2025
whole organism psmd6 expression decreased amount, abnormal psmd6scm40/scm40; twu34Tg standard conditions Fig 4 with image from Farr et al., 2025
heart malformed, abnormal psmd6scm40/scm40; twu34Tg standard conditions Fig 6 with imageFig 7 with image from Farr et al., 2025
whole organism Ab7-ub labeling increased amount, abnormal psmd6scm40/scm40; twu34Tg standard conditions Fig 4 with image from Farr et al., 2025
pericardium edematous, abnormal psmd6scm40/scm40; twu34Tg standard conditions Fig 4 with imageFig 7 with image from Farr et al., 2025
atrium mislocalised ventrally, abnormal psmd6scm40/scm40; twu34Tg standard conditions Fig 4 with image from Farr et al., 2025
cranial skeletal system development process quality, abnormal psmd6scm40/scm40; twu34Tg standard conditions Fig 4 with image from Farr et al., 2025
Citations