CRISPR

CRISPR1-pomp

ID
ZDB-CRISPR-251024-15
Name
CRISPR1-pomp
Previous Names
None
Target
Sequence
5' - GGCTCAGGCTGGTCCTTATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two "G"s were added.
Genome Resources
None
Target Location
View all 6 target locations
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
scm41 pomp
Expression
Gene expression in Wild Types + CRISPR1-pomp
No data available
Phenotype
Phenotype resulting from CRISPR1-pomp
No data available
Phenotype of all Fish created by or utilizing CRISPR1-pomp
Phenotype Fish Conditions Figures
heart looping process quality, abnormal twu34Tg + CRISPR1-pomp + CRISPR2-pomp + CRISPR3-pomp + CRISPR4-pomp standard conditions Fig 3 with image from Farr et al., 2025
atrium mislocalised ventrally, abnormal twu34Tg + CRISPR1-pomp + CRISPR2-pomp + CRISPR3-pomp + CRISPR4-pomp standard conditions Fig 3 with image from Farr et al., 2025
cardiac ventricle mislocalised anteriorly, abnormal twu34Tg + CRISPR1-pomp + CRISPR2-pomp + CRISPR3-pomp + CRISPR4-pomp standard conditions Fig 3 with image from Farr et al., 2025
trabecular layer cardiac muscle cell circular, abnormal pompscm41/scm41; twu34Tg standard conditions Fig 6 with image from Farr et al., 2025
heart contraction decreased rate, abnormal pompscm41/scm41; twu34Tg standard conditions Fig 7 with image from Farr et al., 2025
whole organism psmd6 expression increased amount, abnormal pompscm41/scm41; twu34Tg standard conditions Fig 4 with image from Farr et al., 2025
heart decreased functionality, abnormal pompscm41/scm41; twu34Tg standard conditions Fig 7 with image from Farr et al., 2025
heart looping process quality, abnormal pompscm41/scm41; twu34Tg standard conditions Fig 4 with image from Farr et al., 2025
blood accumulation head, abnormal pompscm41/scm41; twu34Tg standard conditions Fig 4 with image from Farr et al., 2025
heart morphology, abnormal pompscm41/scm41; twu34Tg standard conditions Fig 4 with image from Farr et al., 2025
bulbus arteriosus decreased size, abnormal pompscm41/scm41; twu34Tg standard conditions Fig 9 with image from Farr et al., 2025
whole organism dead, abnormal pompscm41/scm41; twu34Tg standard conditions Fig 4 with image from Farr et al., 2025
heart malformed, abnormal pompscm41/scm41; twu34Tg standard conditions Fig 6 with imageFig 7 with image from Farr et al., 2025
whole organism pomp expression decreased amount, abnormal pompscm41/scm41; twu34Tg standard conditions Fig 4 with image from Farr et al., 2025
whole organism Ab7-ub labeling increased amount, abnormal pompscm41/scm41; twu34Tg standard conditions Fig 4 with image from Farr et al., 2025
cardiac ventricle mislocalised anteriorly, abnormal pompscm41/scm41; twu34Tg standard conditions Fig 4 with image from Farr et al., 2025
cranial skeletal system development process quality, abnormal pompscm41/scm41; twu34Tg standard conditions Fig 4 with image from Farr et al., 2025
atrium mislocalised ventrally, abnormal pompscm41/scm41; twu34Tg standard conditions Fig 4 with image from Farr et al., 2025
pericardium edematous, abnormal pompscm41/scm41; twu34Tg standard conditions Fig 4 with imageFig 7 with image from Farr et al., 2025
Citations