CRISPR

CRISPR6-her6

ID

ZDB-CRISPR-250828-12

Name

CRISPR6-her6

Previous Names

None

Target

her6 (1)

Sequence

5' - GGCGAGAATCAACGAAAGCTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The first "G" was added.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
sud29	her6

Expression

Gene expression in Wild Types + CRISPR6-her6

No data available

Phenotype

Phenotype resulting from CRISPR6-her6

No data available

Phenotype of all Fish created by or utilizing CRISPR6-her6

Phenotype	Fish	Conditions	Figures
forebrain neural keel dla expression mislocalised, abnormal	her6^sud29/sud29	standard conditions	Fig. 4 from Tsuruoka et al., 2025
midbrain neural keel neurog1 expression mislocalised, abnormal	her6^sud29/sud29	standard conditions	FIGURE 8 from Ohyanagi et al., 2025
presumptive rhombomere 3 dla expression mislocalised, abnormal	her6^sud29/sud29	standard conditions	Fig. 4 from Tsuruoka et al., 2025
midbrain neural keel dla expression increased amount, abnormal	her6^sud29/sud29	standard conditions	Fig. 4 from Tsuruoka et al., 2025
forebrain neural keel neurog1 expression mislocalised, abnormal	her6^sud29/sud29	standard conditions	FIGURE 8 from Ohyanagi et al., 2025 Fig. 4 from Tsuruoka et al., 2025
forebrain neural keel her6 expression decreased amount, abnormal	her6^sud29/sud29	standard conditions	FIGURE 7 from Ohyanagi et al., 2025
whole organism dead, abnormal	her6^sud29/sud29	standard conditions	text only from Tsuruoka et al., 2025
presumptive floor plate her6 expression decreased amount, abnormal	her6^sud29/sud29	standard conditions	FIGURE 7 from Ohyanagi et al., 2025
midbrain hindbrain boundary asymmetrical, abnormal	her6^sud29/sud29	standard conditions	Fig. 3 from Tsuruoka et al., 2025
presumptive rhombomere 3 neurog1 expression mislocalised, abnormal	her6^sud29/sud29	standard conditions	FIGURE 8 from Ohyanagi et al., 2025 Fig. 4 from Tsuruoka et al., 2025
forebrain neural keel her4.1 expression mislocalised, abnormal	her6^sud29/sud29	standard conditions	Fig. 4 from Tsuruoka et al., 2025
presumptive rhombomere 3 her4.1 expression mislocalised, abnormal	her6^sud29/sud29	standard conditions	Fig. 4 from Tsuruoka et al., 2025
neural plate anterior-most region dla expression increased amount, abnormal	her6^sud29/sud29	standard conditions	Fig. 4 from Tsuruoka et al., 2025
neural plate anterior-most region neurog1 expression increased amount, abnormal	her6^sud29/sud29	standard conditions	Fig. 4 from Tsuruoka et al., 2025
neurogenesis disrupted, abnormal	her6^sud29/sud29; her3^sud26/sud26	standard conditions	FIGURE 8 from Ohyanagi et al., 2025
presumptive rhombomere 4 neurog1 expression mislocalised, abnormal	her6^sud29/sud29; her3^sud26/sud26	standard conditions	FIGURE 8 from Ohyanagi et al., 2025
midbrain neural keel neurog1 expression mislocalised, abnormal	her6^sud29/sud29; her3^sud26/sud26	standard conditions	FIGURE 8 from Ohyanagi et al., 2025
forebrain neural keel neurog1 expression mislocalised, abnormal	her6^sud29/sud29; her3^sud26/sud26	standard conditions	FIGURE 8 from Ohyanagi et al., 2025
presumptive rhombomere 3 neurog1 expression mislocalised, abnormal	her6^sud29/sud29; her3^sud26/sud26	standard conditions	FIGURE 8 from Ohyanagi et al., 2025

Citations