CRISPR

CRISPR1-slc13a5a

ID
ZDB-CRISPR-250805-2
Name
CRISPR1-slc13a5a
Previous Names
None
Target
Sequence
5' - TGGTCCAGTGCCTGTGAGTGTGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ca204 slc13a5a
Expression
Gene expression in Wild Types + CRISPR1-slc13a5a
No data available
Phenotype
Phenotype resulting from CRISPR1-slc13a5a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-slc13a5a
Phenotype Fish Conditions Figures
CNS neuron (sensu Vertebrata) apoptotic process increased occurrence, abnormal slc13a5aca204/ca204 standard conditions Fig 2 with image from Dogra et al., 2025
midbrain decreased size, abnormal slc13a5aca204/ca204 standard conditions Fig 1 with image from Dogra et al., 2025
optic tectum apoptotic process increased occurrence, abnormal slc13a5aca204/ca204 standard conditions Fig 2 with image from Dogra et al., 2025
auditory behavior increased magnitude, abnormal slc13a5aca204/ca204 standard conditions Fig 2 with image from Dogra et al., 2025
auditory behavior increased magnitude, exacerbated slc13a5aca204/ca204 acoustic radiation Fig 2 with image from Dogra et al., 2025
whole organism dead, abnormal slc13a5aca204/ca204 standard conditions Fig 1 with image from Dogra et al., 2025
optic tectum neuron decreased amount, abnormal slc13a5aca204/ca204 standard conditions Fig 2 with image from Dogra et al., 2025
head slc17a6b expression increased amount, abnormal slc13a5aca204/ca204 standard conditions Fig 3 with image from Dogra et al., 2025
head gad1b expression decreased amount, abnormal slc13a5aca204/ca204 standard conditions Fig 3 with image from Dogra et al., 2025
head fosab expression increased amount, abnormal slc13a5aca204/ca204 standard conditions Fig 3 with image from Dogra et al., 2025
CNS neuron (sensu Vertebrata) calcium atom increased amount, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205 standard conditions Fig 6 with image from Dogra et al., 2025
swimming process quality, ameliorated slc13a5aca204/ca204; slc13a5bca205/ca205 chemical treatment by environment: zinc dichloride Fig 7 with image from Dogra et al., 2025
CNS neuron (sensu Vertebrata) apoptotic process increased occurrence, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205 standard conditions Fig 2 with image from Dogra et al., 2025
optic tectum neuronal action potential increased frequency, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205 standard conditions Fig 3 with image from Dogra et al., 2025
optic tectum neuron Ab1-grin1 labeling increased amount, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205 standard conditions Fig 6 with image from Dogra et al., 2025
optic tectum neuron fosab expression increased amount, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205 standard conditions Fig 3 with image from Dogra et al., 2025
optic tectum neuronal action potential increased magnitude, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205 standard conditions Fig 3 with image from Dogra et al., 2025
aerobic respiration magnitude, ameliorated slc13a5aca204/ca204; slc13a5bca205/ca205 chemical treatment by environment: dizocilpine Fig 7 with image from Dogra et al., 2025
optic tectum apoptotic process increased occurrence, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205 standard conditions Fig 2 with image from Dogra et al., 2025
swimming increased linear velocity, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205 standard conditions Fig 7 with image from Dogra et al., 2025
auditory behavior increased magnitude, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205 standard conditions Fig 2 with image from Dogra et al., 2025
midbrain decreased size, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205 standard conditions Fig 1 with image from Dogra et al., 2025
whole organism dead, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205 standard conditions Fig 1 with image from Dogra et al., 2025
aerobic respiration magnitude, ameliorated slc13a5aca204/ca204; slc13a5bca205/ca205 chemical treatment by environment: memantine Fig 7 with image from Dogra et al., 2025
aerobic respiration decreased magnitude, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205 standard conditions Fig 4 with image,  Fig 7 with image from Dogra et al., 2025
whole organism zinc atom increased amount, ameliorated slc13a5aca204/ca204; slc13a5bca205/ca205 chemical treatment by environment: zinc atom Fig 6 with image from Dogra et al., 2025
auditory behavior increased magnitude, exacerbated slc13a5aca204/ca204; slc13a5bca205/ca205 acoustic radiation Fig 2 with image from Dogra et al., 2025
optic tectum neuron decreased amount, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205 standard conditions Fig 2 with image from Dogra et al., 2025
swimming process quality, ameliorated slc13a5aca204/ca204; slc13a5bca205/ca205 chemical treatment by environment: memantine Fig 7 with image from Dogra et al., 2025
head slc17a6b expression increased amount, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205 standard conditions Fig 3 with image from Dogra et al., 2025
head gad1b expression decreased amount, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205 standard conditions Fig 3 with image from Dogra et al., 2025
head fosab expression increased amount, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205 standard conditions Fig 3 with image from Dogra et al., 2025
whole organism zinc atom decreased amount, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205 standard conditions Fig 6 with image from Dogra et al., 2025
forebrain MAPK cascade increased magnitude, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205 standard conditions Fig 6 with image from Dogra et al., 2025
midbrain intracellular calcium ion homeostasis disrupted, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205; jf5Tg standard conditions Fig 7 with image from Dogra et al., 2025
midbrain calcium atom normal amount, ameliorated slc13a5aca204/ca204; slc13a5bca205/ca205; jf5Tg chemical treatment by environment: zinc dichloride Fig 7 with image from Dogra et al., 2025
midbrain calcium atom normal amount, ameliorated slc13a5aca204/ca204; slc13a5bca205/ca205; jf5Tg chemical treatment by environment: memantine Fig 7 with image from Dogra et al., 2025
midbrain intracellular calcium ion homeostasis normal process quality, ameliorated slc13a5aca204/ca204; slc13a5bca205/ca205; jf5Tg chemical treatment by environment: zinc dichloride Fig 7 with image from Dogra et al., 2025
midbrain intracellular calcium ion homeostasis normal process quality, ameliorated slc13a5aca204/ca204; slc13a5bca205/ca205; jf5Tg chemical treatment by environment: memantine Fig 7 with image from Dogra et al., 2025
midbrain calcium atom increased amount, abnormal slc13a5aca204/ca204; slc13a5bca205/ca205; jf5Tg standard conditions Fig 7 with image from Dogra et al., 2025
midbrain intracellular calcium ion homeostasis normal process quality, ameliorated slc13a5aca204/ca204; slc13a5bca205/ca205; jf5Tg + MO1-grin1a + MO1-grin1b standard conditions Fig 7 with image from Dogra et al., 2025
midbrain calcium atom normal amount, ameliorated slc13a5aca204/ca204; slc13a5bca205/ca205; jf5Tg + MO1-grin1a + MO1-grin1b standard conditions Fig 7 with image from Dogra et al., 2025
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.