CRISPR

CRISPR1-tubg1

ID
ZDB-CRISPR-250612-4
Name
CRISPR1-tubg1
Previous Names
None
Target
Sequence
5' - GGATGTTCTCCGGGTTGTAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first "G" was added.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-tubg1
No data available
Phenotype
Phenotype resulting from CRISPR1-tubg1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-tubg1
Phenotype Fish Conditions Figures
olfactory bulb calb2a expression decreased amount, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 3 from Cark et al., 2024
neuron maturation decreased process quality, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 4 from Cark et al., 2024
head elavl3 expression decreased amount, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 3 from Cark et al., 2024
forebrain gabra4 expression decreased amount, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 3 from Cark et al., 2024
head sp5l expression decreased amount, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 control Fig. 5 from Cark et al., 2024
head decreased diameter, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 1 from Cark et al., 2024
brain development disrupted, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 3 from Cark et al., 2024
head lef1 expression decreased amount, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 control Fig. 5 from Cark et al., 2024
forebrain midbrain boundary mag expression decreased amount, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 3 from Cark et al., 2024
cerebellum calb2a expression decreased amount, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 3 from Cark et al., 2024
eye decreased diameter, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 1 from Cark et al., 2024
head ab1-tubg1 labeling decreased amount, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 1 from Cark et al., 2024
midbrain hindbrain boundary gabra4 expression decreased amount, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 3 from Cark et al., 2024
head tubg1 expression decreased amount, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 5 from Cark et al., 2024
forebrain midbrain boundary elavl3 expression decreased amount, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 4 from Cark et al., 2024
retina prox1a expression decreased amount, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 3 from Cark et al., 2024
retina calb2a expression decreased amount, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 3 from Cark et al., 2024
forebrain elavl3 expression decreased amount, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 4 from Cark et al., 2024
forebrain mag expression decreased amount, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 3 from Cark et al., 2024
forebrain midbrain boundary prox1a expression decreased amount, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 3 from Cark et al., 2024
hindbrain calb2a expression decreased amount, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 3 from Cark et al., 2024
head neurod1 expression decreased amount, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 3 from Cark et al., 2024
cerebellum elavl3 expression decreased amount, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 4 from Cark et al., 2024
head decreased size, abnormal AB + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 2 from Cark et al., 2024
canonical Wnt signaling pathway decreased process quality, abnormal ia5Tg + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 5 from Cark et al., 2024
head mCherry expression decreased amount, abnormal ia5Tg + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 5 from Cark et al., 2024
hindbrain myelination decreased occurrence, abnormal ue2Tg + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 4 from Cark et al., 2024
hindbrain EGFP expression decreased amount, abnormal ue2Tg + CRISPR1-tubg1 + CRISPR2-tubg1 + CRISPR3-tubg1 + CRISPR4-tubg1 standard conditions Fig. 4 from Cark et al., 2024
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to report issues or recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.