CRISPR

CRISPR4-hsf1

ID
ZDB-CRISPR-250501-1
Name
CRISPR4-hsf1
Previous Names
None
Target
Sequence
5' - GACCAAACTCTGGACGCTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mb30 hsf1
mb31 hsf1
mb32 hsf1
Expression
Gene expression in Wild Types + CRISPR4-hsf1
No data available
Phenotype
Phenotype resulting from CRISPR4-hsf1
No data available
Phenotype of all Fish created by or utilizing CRISPR4-hsf1
Phenotype Fish Conditions Figures
whole organism dead, abnormal hsf1mb30/mb30 heat shock Fig. 6 with image from Xiao et al., 2025
whole organism hspa1b expression amount, ameliorated hsf1mb30/mb30 heat shock Fig. 7 with image from Xiao et al., 2025
whole organism hspa8b expression amount, ameliorated hsf1mb30/mb30 heat shock Fig. 7 with image from Xiao et al., 2025
whole organism dnaja expression amount, ameliorated hsf1mb30/mb30 heat shock Fig. 7 with image from Xiao et al., 2025
whole organism dead, abnormal hsf1mb31/mb31 heat shock Fig. 6 with image from Xiao et al., 2025
whole organism hspa1b expression amount, ameliorated hsf1mb31/mb31 heat shock Fig. 7 with image from Xiao et al., 2025
whole organism hspa8b expression amount, ameliorated hsf1mb31/mb31 heat shock Fig. 7 with image from Xiao et al., 2025
whole organism dnaja expression amount, ameliorated hsf1mb31/mb31 heat shock Fig. 7 with image from Xiao et al., 2025
whole organism hspa1b expression amount, ameliorated hsf1mb32/mb32 heat shock Fig. 7 with image from Xiao et al., 2025
whole organism dead, abnormal hsf1mb32/mb32 heat shock Fig. 6 with image from Xiao et al., 2025
whole organism hspa8b expression amount, ameliorated hsf1mb32/mb32 heat shock Fig. 7 with image from Xiao et al., 2025
whole organism dnaja expression amount, ameliorated hsf1mb32/mb32 heat shock Fig. 7 with image from Xiao et al., 2025
slow muscle cell myofibril decreased thickness, abnormal smyd1bsa15678/sa15678; hsf1mb30/mb30 standard conditions Fig. 9 with image from Xiao et al., 2025
skeletal muscle dnaja expression amount, ameliorated smyd1bsa15678/sa15678; hsf1mb30/mb30 standard conditions Fig. 8 with image from Xiao et al., 2025
skeletal muscle unc45b expression amount, ameliorated smyd1bsa15678/sa15678; hsf1mb30/mb30 standard conditions Fig. 8 with image from Xiao et al., 2025
skeletal muscle hsc70 expression amount, ameliorated smyd1bsa15678/sa15678; hsf1mb30/mb30 standard conditions Fig. 8 with image from Xiao et al., 2025
slow muscle cell skeletal muscle fiber development disrupted, abnormal smyd1bsa15678/sa15678; hsf1mb30/mb30 standard conditions Fig. 9 with image from Xiao et al., 2025
skeletal muscle hspa8b expression amount, ameliorated smyd1bsa15678/sa15678; hsf1mb30/mb30 standard conditions Fig. 8 with image from Xiao et al., 2025
slow muscle cell myofibril decreased thickness, abnormal smyd1bsa15678/sa15678; hsf1mb31/mb31 standard conditions Fig. 9 with image from Xiao et al., 2025
skeletal muscle dnaja expression amount, ameliorated smyd1bsa15678/sa15678; hsf1mb31/mb31 standard conditions Fig. 8 with image from Xiao et al., 2025
skeletal muscle unc45b expression amount, ameliorated smyd1bsa15678/sa15678; hsf1mb31/mb31 standard conditions Fig. 8 with image from Xiao et al., 2025
skeletal muscle hsc70 expression amount, ameliorated smyd1bsa15678/sa15678; hsf1mb31/mb31 standard conditions Fig. 8 with image from Xiao et al., 2025
slow muscle cell skeletal muscle fiber development disrupted, abnormal smyd1bsa15678/sa15678; hsf1mb31/mb31 standard conditions Fig. 9 with image from Xiao et al., 2025
skeletal muscle hspa8b expression amount, ameliorated smyd1bsa15678/sa15678; hsf1mb31/mb31 standard conditions Fig. 8 with image from Xiao et al., 2025
slow muscle cell myofibril decreased thickness, abnormal smyd1bsa15678/sa15678; hsf1mb32/mb32 standard conditions Fig. 9 with image from Xiao et al., 2025
skeletal muscle hspa8b expression amount, ameliorated smyd1bsa15678/sa15678; hsf1mb32/mb32 standard conditions Fig. 8 with image from Xiao et al., 2025
skeletal muscle hsc70 expression amount, ameliorated smyd1bsa15678/sa15678; hsf1mb32/mb32 standard conditions Fig. 8 with image from Xiao et al., 2025
slow muscle cell skeletal muscle fiber development disrupted, abnormal smyd1bsa15678/sa15678; hsf1mb32/mb32 standard conditions Fig. 9 with image from Xiao et al., 2025
skeletal muscle unc45b expression amount, ameliorated smyd1bsa15678/sa15678; hsf1mb32/mb32 standard conditions Fig. 8 with image from Xiao et al., 2025
skeletal muscle dnaja expression amount, ameliorated smyd1bsa15678/sa15678; hsf1mb32/mb32 standard conditions Fig. 8 with image from Xiao et al., 2025
Citations