CRISPR

CRISPR1-wnt8b

ID

ZDB-CRISPR-250131-68

Name

CRISPR1-wnt8b

Previous Names

None

Target

wnt8b (1)

Sequence

5' - ACCCACAGCGGACTCAGAAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "CGG" at the 3' UTR.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
chb25	wnt8b

Expression

Gene expression in Wild Types + CRISPR1-wnt8b

No data available

Phenotype

Phenotype resulting from CRISPR1-wnt8b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-wnt8b

Phenotype	Fish	Conditions	Figures
head grin1b expression decreased amount, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head ogt.1 expression decreased amount, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
neurotransmitter transport decreased process quality, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head otomp expression increased amount, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
neuron projection morphogenesis decreased process quality, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
optic tectum neuronal action potential ictal, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 2 from LaCoursiere et al., 2024
head nktr expression decreased amount, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head rbm39a expression decreased amount, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
neuron projection extension decreased process quality, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head col2a1a expression increased amount, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head arglu1a expression decreased amount, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head srsf3b expression decreased amount, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head fn1b expression increased amount, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
axonogenesis decreased process quality, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head col4a1 expression increased amount, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head leg1.1 expression increased amount, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
synaptic vesicle endocytosis decreased process quality, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head pnp5a expression increased amount, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
axon development decreased process quality, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head fkbp5 expression increased amount, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head rhcga expression increased amount, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
presynaptic endocytosis decreased process quality, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
vesicle-mediated transport in synapse decreased process quality, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
signal release from synapse decreased process quality, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head crebzf expression decreased amount, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
axon guidance decreased process quality, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head srsf11 expression decreased amount, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
sodium ion transmembrane transport decreased process quality, abnormal	wnt8b^chb25/chb25	standard conditions	Fig. 4 from LaCoursiere et al., 2024
optic tectum neuronal action potential ictal, abnormal	wnt8b^chb25/+	standard conditions	Fig. 2 from LaCoursiere et al., 2024
swimming behavior ictal, abnormal	wnt8b^chb25/+	light duration	Fig. 1 from LaCoursiere et al., 2024
optic tectum GABAergic neuron GFP expression decreased amount, abnormal	wnt8b^chb25/+; ot1Tg/ot1Tg	standard conditions	Fig. 3 from LaCoursiere et al., 2024
optic tectum interneuron GFP expression decreased amount, abnormal	wnt8b^chb25/+; ot1Tg/ot1Tg	standard conditions	Fig. 3 from LaCoursiere et al., 2024
optic tectum GABAergic neuron GFP expression decreased amount, abnormal	wnt8b^chb25/chb25; ot1Tg/ot1Tg	standard conditions	Fig. 3 from LaCoursiere et al., 2024
optic tectum interneuron GFP expression decreased amount, abnormal	wnt8b^chb25/chb25; ot1Tg/ot1Tg	standard conditions	Fig. 3 from LaCoursiere et al., 2024

Citations