CRISPR

CRISPR6-hmox1a

ID
ZDB-CRISPR-241218-9
Name
CRISPR6-hmox1a
Previous Names
None
Target
Sequence
5' - GGGCGGCAGAGAACACTGGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two "G"s were added.
Genome Resources
None
Target Location
View all 4 target locations
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf4175 hmox1a
Expression
Gene expression in Wild Types + CRISPR6-hmox1a
No data available
Phenotype
Phenotype resulting from CRISPR6-hmox1a
No data available
Phenotype of all Fish created by or utilizing CRISPR6-hmox1a
Phenotype Fish Conditions Figures
whole organism slc34a2a expression increased amount, abnormal hmox1azf4175/zf4175 chemical treatment by environment: arecoline, chemical treatment by environment: ferric ammonium citrate Figure 7 with image from Jiang et al., 2024
whole organism slc34a2a expression amount, ameliorated hmox1azf4175/zf4175 chemical treatment by environment: ferric ammonium citrate, chemical treatment by environment: arecoline, chemical treatment by environment: ferrostatin-1 Figure 7 with image from Jiang et al., 2024
whole organism hmox1a expression decreased amount, abnormal hmox1azf4175/zf4175 control Figure 7 with image from Jiang et al., 2024
whole organism reactive oxygen species increased amount, abnormal hmox1azf4175/zf4175 chemical treatment by environment: arecoline, chemical treatment by environment: ferric ammonium citrate Figure 7 with image from Jiang et al., 2024
vertebra decreased mass density, abnormal hmox1azf4175/zf4175 chemical treatment by environment: arecoline, chemical treatment by environment: ferric ammonium citrate Figure 7 with image from Jiang et al., 2024
whole organism spp1 expression decreased amount, abnormal hmox1azf4175/zf4175 chemical treatment by environment: arecoline, chemical treatment by environment: ferric ammonium citrate Figure 7 with image from Jiang et al., 2024
whole organism runx2a expression decreased amount, abnormal hmox1azf4175/zf4175 chemical treatment by environment: arecoline, chemical treatment by environment: ferric ammonium citrate Figure 7 with image from Jiang et al., 2024
whole organism hmox1a expression amount, ameliorated hmox1azf4175/zf4175 chemical treatment by environment: arecoline, chemical treatment by environment: ferric ammonium citrate Figure 7 with image from Jiang et al., 2024
cranium bone mineralization decreased process quality, abnormal hmox1azf4175/zf4175 chemical treatment by environment: arecoline, chemical treatment by environment: ferric ammonium citrate Figure 7 with image from Jiang et al., 2024
whole organism hmox1a expression amount, ameliorated hmox1azf4175/zf4175 chemical treatment by environment: ferric ammonium citrate Figure 7 with image from Jiang et al., 2024
whole organism reactive oxygen species amount, ameliorated hmox1azf4175/zf4175 chemical treatment by environment: ferric ammonium citrate, chemical treatment by environment: arecoline, chemical treatment by environment: ferrostatin-1 Figure 7 with image from Jiang et al., 2024
whole organism bglap expression decreased amount, abnormal hmox1azf4175/zf4175 chemical treatment by environment: arecoline, chemical treatment by environment: ferric ammonium citrate Figure 7 with image from Jiang et al., 2024
Citations