CRISPR

CRISPR3-apoeb

ID
ZDB-CRISPR-240109-2
Name
CRISPR3-apoeb
Previous Names
None
Target
Sequence
5' - GATGACGTGAAGAACCGTGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
sih4 apoeb
zko3619a apoeb
Expression
Gene expression in Wild Types + CRISPR3-apoeb
No data available
Phenotype
Phenotype resulting from CRISPR3-apoeb
No data available
Phenotype of all Fish created by or utilizing CRISPR3-apoeb
Phenotype Fish Conditions Figures
intersegmental vessel decreased diameter, abnormal apoebsih4/sih4 standard conditions Fig. 3 from Hu et al., 2022
whole organism tnfa expression increased amount, abnormal apoebsih4/sih4 high fat Fig. 6 from Hu et al., 2022
whole organism low-density lipoprotein cholesterol increased amount, abnormal apoebsih4/sih4 standard conditions Fig. 2 from Hu et al., 2022
whole organism hmgcra expression increased amount, abnormal apoebsih4/sih4 chemical treatment by diet: mixture, high fat Fig. 5 from Hu et al., 2022
whole organism very-low-density lipoprotein amount, ameliorated apoebsih4/sih4 chemical treatment by diet: mixture, high fat Fig. 5 from Hu et al., 2022
liver hmgcra expression increased amount, abnormal apoebsih4/sih4 standard conditions Fig. 2 from Hu et al., 2022
whole organism high-density lipoprotein cholesterol increased amount, abnormal apoebsih4/sih4 chemical treatment by diet: mixture, high fat Fig. 5 from Hu et al., 2022
whole organism srebf2 expression increased amount, abnormal apoebsih4/sih4 chemical treatment by diet: ezetimibe, high fat Fig. 5 from Hu et al., 2022
whole organism il1b expression amount, ameliorated apoebsih4/sih4 chemical treatment by diet: ezetimibe, high fat Fig. 6 from Hu et al., 2022
whole organism lipid increased amount, abnormal apoebsih4/sih4 high fat Fig. 4Fig. 5 from Hu et al., 2022
whole organism lipid amount, ameliorated apoebsih4/sih4 chemical treatment by diet: simvastatin, high fat Fig. 5 from Hu et al., 2022
liver fasn expression increased amount, abnormal apoebsih4/sih4 standard conditions Fig. 2 from Hu et al., 2022
liver ldlra expression increased amount, abnormal apoebsih4/sih4 standard conditions Fig. 2 from Hu et al., 2022
whole organism ldlra expression increased amount, abnormal apoebsih4/sih4 chemical treatment by diet: ezetimibe, high fat Fig. 5 from Hu et al., 2022
whole organism hmgcra expression increased amount, abnormal apoebsih4/sih4 chemical treatment by diet: ezetimibe, high fat Fig. 5 from Hu et al., 2022
whole organism srebf1 expression increased amount, abnormal apoebsih4/sih4 high fat Fig. 4 from Hu et al., 2022
whole organism lipid amount, ameliorated apoebsih4/sih4 chemical treatment by diet: mixture, high fat Fig. 5 from Hu et al., 2022
vasculature lipid amount, ameliorated apoebsih4/sih4 chemical treatment by diet: mixture, high fat Fig. 5Fig. 6 from Hu et al., 2022
vasculature lipid increased amount, abnormal apoebsih4/sih4 high fat Fig. 5Fig. 6 from Hu et al., 2022
whole organism cholesterol amount, ameliorated apoebsih4/sih4 chemical treatment by diet: mixture, high fat Fig. 5 from Hu et al., 2022
liver srebf1 expression increased amount, abnormal apoebsih4/sih4 standard conditions Fig. 2 from Hu et al., 2022
vasculature cholesteryl ester increased amount, abnormal apoebsih4/sih4 high fat Fig. 4 from Hu et al., 2022
whole organism hmgcra expression increased amount, abnormal apoebsih4/sih4 high fat Fig. 4 from Hu et al., 2022
whole organism very-low-density lipoprotein amount, ameliorated apoebsih4/sih4 chemical treatment by diet: ezetimibe, high fat Fig. 5 from Hu et al., 2022
whole organism triglyceride increased amount, abnormal apoebsih4/sih4 high fat Fig. 2Fig. 4Fig. 5 from Hu et al., 2022
whole organism low-density lipoprotein cholesterol increased amount, abnormal apoebsih4/sih4 high fat Fig. 2Fig. 4Fig. 5 from Hu et al., 2022
whole organism very-low-density lipoprotein increased amount, abnormal apoebsih4/sih4 high fat Fig. 2Fig. 4Fig. 5 from Hu et al., 2022
whole organism ldlra expression increased amount, abnormal apoebsih4/sih4 chemical treatment by diet: mixture, high fat Fig. 5 from Hu et al., 2022
whole organism triglyceride amount, ameliorated apoebsih4/sih4 chemical treatment by diet: mixture, high fat Fig. 5 from Hu et al., 2022
whole organism tnfa expression amount, ameliorated apoebsih4/sih4 chemical treatment by diet: ezetimibe, high fat Fig. 6 from Hu et al., 2022
vasculature lipid amount, ameliorated apoebsih4/sih4 chemical treatment by diet: ezetimibe, high fat Fig. 5 from Hu et al., 2022
whole organism cholesterol increased amount, abnormal apoebsih4/sih4 standard conditions Fig. 2 from Hu et al., 2022
whole organism low-density lipoprotein cholesterol amount, ameliorated apoebsih4/sih4 chemical treatment by diet: mixture, high fat Fig. 5 from Hu et al., 2022
whole organism cholesterol increased amount, abnormal apoebsih4/sih4 high fat Fig. 2Fig. 4Fig. 5 from Hu et al., 2022
whole organism srebf2 expression increased amount, abnormal apoebsih4/sih4 high fat Fig. 4 from Hu et al., 2022
whole organism triglyceride amount, ameliorated apoebsih4/sih4 chemical treatment by diet: ezetimibe, high fat Fig. 5 from Hu et al., 2022
whole organism cholesterol amount, ameliorated apoebsih4/sih4 chemical treatment by diet: ezetimibe, high fat Fig. 5 from Hu et al., 2022
whole organism low-density lipoprotein cholesterol amount, ameliorated apoebsih4/sih4 chemical treatment by diet: ezetimibe, high fat Fig. 5 from Hu et al., 2022
whole organism srebf1 expression increased amount, abnormal apoebsih4/sih4 chemical treatment by diet: ezetimibe, high fat Fig. 5 from Hu et al., 2022
whole organism pcsk9 expression increased amount, abnormal apoebsih4/sih4 chemical treatment by diet: mixture, high fat Fig. 5 from Hu et al., 2022
whole organism ldlra expression increased amount, abnormal apoebsih4/sih4 high fat Fig. 4 from Hu et al., 2022
whole organism high-density lipoprotein cholesterol increased amount, abnormal apoebsih4/sih4 chemical treatment by diet: ezetimibe, high fat Fig. 5 from Hu et al., 2022
whole organism srebf2 expression increased amount, abnormal apoebsih4/sih4 chemical treatment by diet: mixture, high fat Fig. 5 from Hu et al., 2022
whole organism il1b expression amount, ameliorated apoebsih4/sih4 chemical treatment by diet: mixture, high fat Fig. 6 from Hu et al., 2022
vasculature lipid amount, ameliorated apoebsih4/sih4 chemical treatment by diet: simvastatin, high fat Fig. 5Fig. 6 from Hu et al., 2022
whole organism fasn expression increased amount, abnormal apoebsih4/sih4 high fat Fig. 4 from Hu et al., 2022
whole organism very-low-density lipoprotein increased amount, abnormal apoebsih4/sih4 standard conditions Fig. 2 from Hu et al., 2022
whole organism lipid amount, ameliorated apoebsih4/sih4 chemical treatment by diet: ezetimibe, high fat Fig. 5 from Hu et al., 2022
trunk vasculature neutrophil amount, ameliorated apoebsih4/sih4; pd27Tg; rj1Tg chemical treatment by diet: mixture, high fat Fig. 6 from Hu et al., 2022
trunk vasculature neutrophil amount, ameliorated apoebsih4/sih4; pd27Tg; rj1Tg chemical treatment by diet: simvastatin, high fat Fig. 6 from Hu et al., 2022
trunk vasculature neutrophil increased amount, abnormal apoebsih4/sih4; pd27Tg; rj1Tg high fat Fig. 6 from Hu et al., 2022
hindbrain hemorrhagic, abnormal apoebsih4/sih4; y1Tg standard conditions Fig. 3 from Hu et al., 2022
midbrain hemorrhagic, abnormal apoebsih4/sih4; y1Tg standard conditions Fig. 3 from Hu et al., 2022
posterior cerebral vein decreased width, abnormal apoebsih4/sih4; y1Tg standard conditions Fig. 3 from Hu et al., 2022
primordial hindbrain channel absent, abnormal apoebsih4/sih4; y1Tg standard conditions Fig. 3 from Hu et al., 2022
Citations