CRISPR

CRISPR1-foxe1

ID
ZDB-CRISPR-230726-8
Name
CRISPR1-foxe1
Previous Names
None
Target
Sequence
5' - GCCGCAAAGAGGCCGTCGGAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
rdb2 foxe1
Expression
Gene expression in Wild Types + CRISPR1-foxe1
No data available
Phenotype
Phenotype resulting from CRISPR1-foxe1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-foxe1
Phenotype Fish Conditions Figures
whole organism col1a2 expression decreased amount, abnormal foxe1rdb2/rdb2 (AB) standard conditions FIGURE 8 with image from Raterman et al., 2023
whole organism col2a1a expression decreased amount, abnormal foxe1rdb2/rdb2 (AB) standard conditions FIGURE 8 with image from Raterman et al., 2023
whole organism sp7 expression decreased amount, abnormal foxe1rdb2/rdb2 (AB) standard conditions FIGURE 8 with image from Raterman et al., 2023
whole organism calcium cation decreased amount, abnormal foxe1rdb2/rdb2 (AB) standard conditions FIGURE 7 with image from Raterman et al., 2023
whole organism phosphate decreased amount, abnormal foxe1rdb2/rdb2 (AB) standard conditions FIGURE 7 with image from Raterman et al., 2023
cranial neural crest cell dlx2a expression decreased distribution, abnormal foxe1rdb2/rdb2 (AB) standard conditions FIGURE 8 with image from Raterman et al., 2023
whole organism magnesium cation decreased amount, abnormal foxe1rdb2/rdb2 (AB) standard conditions FIGURE 7 with image from Raterman et al., 2023
whole organism runx2b expression increased amount, abnormal foxe1rdb2/rdb2 (AB) standard conditions FIGURE 8 with image from Raterman et al., 2023
whole organism sox9a expression increased amount, abnormal foxe1rdb2/rdb2 (AB) standard conditions FIGURE 8 with image from Raterman et al., 2023
ceratohyal cartilage kinked, abnormal foxe1rdb2/rdb2 (AB) standard conditions FIGURE 7 with image from Raterman et al., 2023
ethmoid cartilage foxe1 expression increased distribution, abnormal foxe1rdb2/rdb2 (AB) standard conditions FIGURE 5 with image from Raterman et al., 2023
keratinocyte cytoplasm foxe1 expression mislocalised, abnormal foxe1rdb2/rdb2 (AB) standard conditions FIGURE 4 with image from Raterman et al., 2023
whole organism dlx2a expression increased amount, abnormal foxe1rdb2/rdb2 (AB) standard conditions FIGURE 8 with image from Raterman et al., 2023
oral epithelium foxe1 expression increased distribution, abnormal foxe1rdb2/rdb2 (AB) standard conditions FIGURE 5 with image from Raterman et al., 2023
whole organism col1a2 expression increased amount, abnormal foxe1rdb2/rdb2 (AB) standard conditions FIGURE 8 with image from Raterman et al., 2023
whole organism tgfb3 expression increased amount, abnormal foxe1rdb2/rdb2 (AB) standard conditions FIGURE 8 with image from Raterman et al., 2023
whole organism wnt5a expression increased amount, abnormal foxe1rdb2/rdb2 (AB) standard conditions FIGURE 8 with image from Raterman et al., 2023
whole organism col1a2 expression decreased amount, abnormal foxe1rdb2/+ (AB) standard conditions FIGURE 8 with image from Raterman et al., 2023
whole organism fgfr2 expression increased amount, abnormal foxe1rdb2/+ (AB) standard conditions FIGURE 8 with image from Raterman et al., 2023
whole organism sox9a expression increased amount, abnormal foxe1rdb2/+ (AB) standard conditions FIGURE 8 with image from Raterman et al., 2023
cranial neural crest cell dlx2a expression decreased distribution, abnormal foxe1rdb2/+ (AB) standard conditions FIGURE 8 with image from Raterman et al., 2023
whole organism runx2b expression increased amount, abnormal foxe1rdb2/+ (AB) standard conditions FIGURE 8 with image from Raterman et al., 2023
whole organism dlx2a expression increased amount, abnormal foxe1rdb2/+ (AB) standard conditions FIGURE 8 with image from Raterman et al., 2023
whole organism col1a2 expression increased amount, abnormal foxe1rdb2/+ (AB) standard conditions FIGURE 8 with image from Raterman et al., 2023
Citations