CRISPR

CRISPR11-wfikkn1

ID

ZDB-CRISPR-221116-4

Name

CRISPR11-wfikkn1

Previous Names

None

Target

wfikkn1 (1)

Sequence

5' - GGTGGAGGCGTGGGGTCCTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "CGG" at the 3 end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
osu2	wfikkn1

Expression

Gene expression in Wild Types + CRISPR11-wfikkn1

No data available

Phenotype

Phenotype resulting from CRISPR11-wfikkn1

No data available

Phenotype of all Fish created by or utilizing CRISPR11-wfikkn1

Phenotype	Fish	Conditions	Figures
whole organism cyp1a expression increased amount, abnormal	wfikkn1^osu2/osu2	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4 from Shankar et al., 2022
whole organism mhc1uba expression decreased amount, abnormal	wfikkn1^osu2/osu2	standard conditions	Fig. 4 from Shankar et al., 2022
social behavior disrupted, abnormal	wfikkn1^osu2/osu2	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 10 from Shankar et al., 2022
whole organism olig4 expression decreased amount, abnormal	wfikkn1^osu2/osu2	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4 from Shankar et al., 2022
whole organism mhc1uba expression decreased amount, abnormal	wfikkn1^osu2/osu2	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4 from Shankar et al., 2022
whole organism cyp1c2 expression increased amount, abnormal	wfikkn1^osu2/osu2	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4 from Shankar et al., 2022
whole organism zp2l2 expression decreased amount, abnormal	wfikkn1^osu2/osu2	standard conditions	Fig. 4 from Shankar et al., 2022
whole organism ahrra expression increased amount, abnormal	wfikkn1^osu2/osu2	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4 from Shankar et al., 2022
whole organism areg expression decreased amount, abnormal	wfikkn1^osu2/osu2	standard conditions	Fig. 4 from Shankar et al., 2022
whole organism ifit8 expression increased amount, abnormal	wfikkn1^osu2/osu2	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4 from Shankar et al., 2022
whole organism rims3 expression decreased amount, abnormal	wfikkn1^osu2/osu2	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4 from Shankar et al., 2022
whole organism ugt2a6 expression decreased amount, abnormal	wfikkn1^osu2/osu2	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4 from Shankar et al., 2022
whole organism areg expression decreased amount, abnormal	wfikkn1^osu2/osu2	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4 from Shankar et al., 2022
whole organism fsd1l expression decreased amount, abnormal	wfikkn1^osu2/osu2	standard conditions	Fig. 4 from Shankar et al., 2022
whole organism mhc1zka expression increased amount, abnormal	wfikkn1^osu2/osu2	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4 from Shankar et al., 2022
whole organism ifit8 expression increased amount, abnormal	wfikkn1^osu2/osu2	standard conditions	Fig. 4 from Shankar et al., 2022
social behavior disrupted, abnormal	wfikkn1^osu2/osu2	standard conditions	Fig. 10 from Shankar et al., 2022
whole organism slc6a17 expression increased amount, abnormal	wfikkn1^osu2/osu2	standard conditions	Fig. 4 from Shankar et al., 2022
whole organism hmcn2 expression decreased amount, abnormal	wfikkn1^osu2/osu2	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4 from Shankar et al., 2022
whole organism olig4 expression decreased amount, abnormal	wfikkn1^osu2/osu2	standard conditions	Fig. 4 from Shankar et al., 2022
whole organism phf5a expression increased amount, abnormal	wfikkn1^osu2/osu2	standard conditions	Fig. 4 from Shankar et al., 2022
whole organism znf1094 expression increased amount, abnormal	wfikkn1^osu2/osu2	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4 from Shankar et al., 2022
whole organism slc6a17 expression decreased amount, abnormal	wfikkn1^osu2/osu2	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4 from Shankar et al., 2022
locomotion occurrence, ameliorated	wfikkn1^osu2/osu2	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 10 from Shankar et al., 2022
whole organism cyp1c1 expression increased amount, abnormal	wfikkn1^osu2/osu2	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4 from Shankar et al., 2022
locomotion decreased occurrence, abnormal	wfikkn1^osu2/osu2	standard conditions	Fig. 10 from Shankar et al., 2022
whole organism nr6a1a expression decreased amount, abnormal	wfikkn1^osu2/osu2	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4 from Shankar et al., 2022
whole organism phf5a expression increased amount, abnormal	wfikkn1^osu2/osu2	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4 from Shankar et al., 2022
whole organism tia1 expression decreased amount, abnormal	wfikkn1^osu2/osu2	chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine	Fig. 4 from Shankar et al., 2022
whole organism pimr134 expression increased amount, abnormal	wfikkn1^osu2/osu2	standard conditions	Fig. 4 from Shankar et al., 2022

Citations