CRISPR

CRISPR1-gdf5

ID
ZDB-CRISPR-221021-1
Name
CRISPR1-gdf5
Previous Names
None
Target
Sequence
5' - GAGAGTCCATGTGCTTCTTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
uu3703 gdf5
Expression
Gene expression in Wild Types + CRISPR1-gdf5
No data available
Phenotype
Phenotype resulting from CRISPR1-gdf5
No data available
Phenotype of all Fish created by or utilizing CRISPR1-gdf5
Phenotype Fish Conditions Figures
hypural 1 truncated, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 3 with image from Waldmann et al., 2021
pectoral girdle porosity, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 2 with image from Waldmann et al., 2021
notochord ossification decreased process quality, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 6 with image from Waldmann et al., 2021
hemal spine deformed, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 3 with image from Waldmann et al., 2021
neural spine morphology, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 4 with image from Waldmann et al., 2021
hemal spine truncated, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 3 with image from Waldmann et al., 2021
anal fin proximal radial shortened, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 4 with image from Waldmann et al., 2021
pectoral fin proximal radial absent, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 2 with image from Waldmann et al., 2021
pectoral fin bone element mislocalised, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 2 with image from Waldmann et al., 2021
pectoral fin distal radial fused with pectoral fin distal radial, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 2 with image from Waldmann et al., 2021
pectoral fin proximal radial decreased size, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 2 with image from Waldmann et al., 2021
pectoral fin proximal radial decreased amount, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 2 with image from Waldmann et al., 2021
hypural 1 structurally discontinuous, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 3 with image from Waldmann et al., 2021
hypural 4 shortened, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 3 with image from Waldmann et al., 2021
anal fin proximal radial increased width, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 4 with image from Waldmann et al., 2021
parhypural structurally discontinuous, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 3 with image from Waldmann et al., 2021
hypural 5 shortened, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 3 with image from Waldmann et al., 2021
dorsal fin proximal radial increased width, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 4 with image from Waldmann et al., 2021
pectoral fin distal radial decreased size, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 2 with image from Waldmann et al., 2021
parhypural truncated, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 3 with image from Waldmann et al., 2021
hypural morphology, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 4 with image from Waldmann et al., 2021
hypural 1 deformed, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 3 with image from Waldmann et al., 2021
parhypural deformed, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 3 with image from Waldmann et al., 2021
pectoral fin distal radial absent, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 2 with image from Waldmann et al., 2021
epural morphology, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 4 with image from Waldmann et al., 2021
hypural 3 shortened, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 3 with image from Waldmann et al., 2021
urostyle morphology, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 4 with image from Waldmann et al., 2021
dorsal fin proximal radial shortened, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 4 with image from Waldmann et al., 2021
pectoral fin cartilage endochondral ossification absent process, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 2 with image from Waldmann et al., 2021
dorsal fin radial truncated, abnormal gdf5uu3703/uu3703 (AB) standard conditions Fig. 3 with image from Waldmann et al., 2021
Citations