CRISPR

CRISPR3-ltbp1

ID

ZDB-CRISPR-221017-4

Name

CRISPR3-ltbp1

Previous Names

None

Target

ltbp1 (1)

Sequence

5' - GGATGCCTGTTGTGGGACGGTGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
fb29	ltbp1

Expression

Gene expression in Wild Types + CRISPR3-ltbp1

No data available

Phenotype

Phenotype resulting from CRISPR3-ltbp1

No data available

Phenotype of all Fish created by or utilizing CRISPR3-ltbp1

Phenotype	Fish	Conditions	Figures
bulbus arteriosus smooth muscle cell increased size, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28	standard conditions	Fig. 3 from Abrial et al., 2022
whole organism nppb expression increased amount, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28	standard conditions	Fig. 2 from Abrial et al., 2022
heart edematous, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28	standard conditions	Fig. 1 from Abrial et al., 2022
bulbus arteriosus thbs1a expression increased amount, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28	standard conditions	Fig. 6 from Abrial et al., 2022
bulbus arteriosus distended, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28	standard conditions	Fig. 1 , Fig. 4 from Abrial et al., 2022
bulbus arteriosus transforming growth factor beta receptor signaling pathway increased process quality, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28	standard conditions	Fig. 4 from Abrial et al., 2022
bulbus arteriosus has extra parts of type smooth muscle cell, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28	standard conditions	Fig. 3 from Abrial et al., 2022
bulbus arteriosus increased diameter, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28	standard conditions	Fig. 3 , Fig. 5 from Abrial et al., 2022
atrioventricular canal thbs1a expression increased amount, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28	standard conditions	Fig. 6 from Abrial et al., 2022
cardiac ventricle increased area, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28	standard conditions	Fig. 2 , Fig. 5 from Abrial et al., 2022
whole organism nppa expression increased amount, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28	standard conditions	Fig. 2 from Abrial et al., 2022
mandibular arch skeleton protruding, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28	standard conditions	Fig. 1 from Abrial et al., 2022
heart nppa expression increased amount, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28	standard conditions	Fig. 2 from Abrial et al., 2022
cardiac ventricle dilated, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28	standard conditions	Fig. 1 , Fig. 4 from Abrial et al., 2022
bulbus arteriosus tgfb1b expression increased amount, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28	standard conditions	Fig. 6 from Abrial et al., 2022
bulbus arteriosus nucleus ab2-smad3 labeling increased amount, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28	standard conditions	Fig. 4 from Abrial et al., 2022
bulbus arteriosus tgfbr2a expression increased amount, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28	standard conditions	Fig. 6 from Abrial et al., 2022
bulbus arteriosus serpine1 expression increased amount, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28	standard conditions	Fig. 6 from Abrial et al., 2022
bulbus arteriosus smooth muscle cell disorganized, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28	standard conditions	Fig. 3 from Abrial et al., 2022
bulbus arteriosus has extra parts of type endothelial cell, abnormal	ltbp1^fb29/fb29; ltbp3^fb28/fb28; y7Tg	standard conditions	Fig. 3 from Abrial et al., 2022

Citations