CRISPR

CRISPR5-dnah10

ID

ZDB-CRISPR-220722-21

Name

CRISPR5-dnah10

Previous Names

None

Target

dnah10 (1)

Sequence

5' - GGATGGCGCCAAGCTCATTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ut28	dnah10

Expression

Gene expression in Wild Types + CRISPR5-dnah10

No data available

Phenotype

Phenotype resulting from CRISPR5-dnah10

No data available

Phenotype of all Fish created by or utilizing CRISPR5-dnah10

Phenotype	Fish	Conditions	Figures
trunk curved, abnormal	dnah10^ut28/ut28 (AB)	standard conditions	Fig. 1 from Wang et al., 2021
trunk kinked, abnormal	dnah10^ut28/ut28 (AB)	standard conditions	Fig. 1 from Wang et al., 2021
trunk kinked, abnormal	dnah10^ut28/ut28 (AB)	standard conditions	Fig. 1 from Wang et al., 2021
trunk curved, abnormal	dnah10^ut28/ut28 (AB)	standard conditions	Fig. 1 from Wang et al., 2021
vertebral column kinked, abnormal	dnah10^ut28/ut28 (AB)	standard conditions	Fig. 1 from Wang et al., 2021
trunk curved, abnormal	dnah10^ut28/ut28 (AB)	standard conditions	Fig. 1 from Wang et al., 2021
trunk kinked, abnormal	dnah10^ut28/ut28 (AB)	standard conditions	Fig. 1 from Wang et al., 2021
Reissner's fiber disassembled, abnormal	dnah10^ut28/ut28 (AB)	standard conditions	Fig. 3 from Wang et al., 2021
vertebral column rotational curvature, abnormal	dnah10^ut28/ut28 (AB)	standard conditions	Fig. 1 from Wang et al., 2021
vertebral column rotational curvature, abnormal	dnah10^ut28/ut28 (AB)	standard conditions	Fig. 1 from Wang et al., 2021
vertebral column rotational curvature, abnormal	dnah10^ut28/ut28 (AB)	standard conditions	Fig. 1 from Wang et al., 2021
vertebral column increased curvature, abnormal	dnah10^ut28/ut28 (AB)	standard conditions	Fig. 1 from Wang et al., 2021
vertebral column increased curvature, abnormal	dnah10^ut28/ut28 (AB)	standard conditions	Fig. 1 from Wang et al., 2021
vertebral column increased curvature, abnormal	dnah10^ut28/ut28 (AB)	standard conditions	Fig. 1 from Wang et al., 2021
vertebral column rotational curvature, abnormal	AB + CRISPR2-dnah10 + CRISPR3-dnah10 + CRISPR4-dnah10 + CRISPR5-dnah10	standard conditions	Fig. 1 from Wang et al., 2021
vertebral column kinked, abnormal	AB + CRISPR2-dnah10 + CRISPR3-dnah10 + CRISPR4-dnah10 + CRISPR5-dnah10	standard conditions	Fig. 1 from Wang et al., 2021
vertebral column increased curvature, abnormal	AB + CRISPR2-dnah10 + CRISPR3-dnah10 + CRISPR4-dnah10 + CRISPR5-dnah10	standard conditions	Fig. 1 from Wang et al., 2021
trunk curved, abnormal	AB + CRISPR2-dnah10 + CRISPR3-dnah10 + CRISPR4-dnah10 + CRISPR5-dnah10	standard conditions	Fig. 1 from Wang et al., 2021
trunk kinked, abnormal	AB + CRISPR2-dnah10 + CRISPR3-dnah10 + CRISPR4-dnah10 + CRISPR5-dnah10	standard conditions	Fig. 1 from Wang et al., 2021
Reissner's fiber disassembled, abnormal	dnah10^ut28/ut28; sspo^ut24Tg/+ (AB)	standard conditions	Fig. 4 from Wang et al., 2021
cilium movement disrupted, abnormal	dnah10^ut28/ut28; sspo^ut24Tg/+ (AB)	standard conditions	Fig. 4 from Wang et al., 2021
trunk curved, abnormal	dnah10^ut28/ut28; ut22Tg/+ (AB)	standard conditions	Fig. 2 from Wang et al., 2021
ventricular system cilium decreased mobility, abnormal	dnah10^ut28/ut28; ut22Tg/+ (AB)	standard conditions	Fig. 2 from Wang et al., 2021
central canal cilium decreased mobility, abnormal	dnah10^ut28/ut28; ut22Tg/+ (AB)	standard conditions	Fig. 2 from Wang et al., 2021
cilium movement disrupted, abnormal	dnah10^ut28/ut28; ut22Tg/+ (AB)	standard conditions	Fig. 2 from Wang et al., 2021

Citations