CRISPR

CRISPR1-vps16

ID

ZDB-CRISPR-220308-1

Name

CRISPR1-vps16

Previous Names

None

Target

vps16 (1)

Sequence

5' - GGGAGTGGCGACACAGACCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The first two "G"s were added.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

No data available

Expression

Gene expression in Wild Types + CRISPR1-vps16

No data available

Phenotype

Phenotype resulting from CRISPR1-vps16

Phenotype	Fish	Figures
astrocyte lysosome increased amount, abnormal	re10Tg + CRISPR1-vps16	Figure 8 from Sofou et al., 2021
brain EGFP expression increased amount, abnormal	zf155Tg + CRISPR1-vps16	Figure 8 from Sofou et al., 2021
brain lysosome increased amount, abnormal	AB + CRISPR1-vps16	Figure 8 from Sofou et al., 2021
brain myelin sheath EGFP expression decreased amount, abnormal	ue2Tg + CRISPR1-vps16	Figure 7 from Sofou et al., 2021
eye translucent, abnormal	AB + CRISPR1-vps16	Figure 7 from Sofou et al., 2021
head melanocyte morphology, abnormal	AB + CRISPR1-vps16	Figure 7 from Sofou et al., 2021
hindbrain myelination disrupted, abnormal	ue2Tg + CRISPR1-vps16	Figure 7 from Sofou et al., 2021
integument decreased pigmentation, abnormal	AB + CRISPR1-vps16	Figure 7 from Sofou et al., 2021
lysosome organization disrupted, abnormal	AB + CRISPR1-vps16	Figure 8 from Sofou et al., 2021
microglial cell morphology, abnormal	gl22Tg + CRISPR1-vps16	Figure 8 from Sofou et al., 2021
microglial cell lysosome increased amount, abnormal	gl22Tg + CRISPR1-vps16	Figure 8 from Sofou et al., 2021
midbrain myelination disrupted, abnormal	ue2Tg + CRISPR1-vps16	Figure 7 from Sofou et al., 2021
optic tectum EGFP expression increased amount, abnormal	zf155Tg + CRISPR1-vps16	Figure 8 from Sofou et al., 2021
retinal pigmented epithelium decreased pigmentation, abnormal	AB + CRISPR1-vps16	Figure 7 from Sofou et al., 2021
swim bladder aplastic, abnormal	AB + CRISPR1-vps16	Figure 7 from Sofou et al., 2021

Phenotype of all Fish created by or utilizing CRISPR1-vps16

Phenotype	Fish	Conditions	Figures
integument decreased pigmentation, abnormal	AB + CRISPR1-vps16	standard conditions	Figure 7 from Sofou et al., 2021
eye translucent, abnormal	AB + CRISPR1-vps16	standard conditions	Figure 7 from Sofou et al., 2021
head melanocyte morphology, abnormal	AB + CRISPR1-vps16	standard conditions	Figure 7 from Sofou et al., 2021
brain lysosome increased amount, abnormal	AB + CRISPR1-vps16	standard conditions	Figure 8 from Sofou et al., 2021
swim bladder aplastic, abnormal	AB + CRISPR1-vps16	standard conditions	Figure 7 from Sofou et al., 2021
lysosome organization disrupted, abnormal	AB + CRISPR1-vps16	standard conditions	Figure 8 from Sofou et al., 2021
retinal pigmented epithelium decreased pigmentation, abnormal	AB + CRISPR1-vps16	standard conditions	Figure 7 from Sofou et al., 2021
microglial cell lysosome increased amount, abnormal	gl22Tg + CRISPR1-vps16	standard conditions	Figure 8 from Sofou et al., 2021
microglial cell morphology, abnormal	gl22Tg + CRISPR1-vps16	standard conditions	Figure 8 from Sofou et al., 2021
astrocyte lysosome increased amount, abnormal	re10Tg + CRISPR1-vps16	standard conditions	Figure 8 from Sofou et al., 2021
hindbrain myelination disrupted, abnormal	ue2Tg + CRISPR1-vps16	standard conditions	Figure 7 from Sofou et al., 2021
brain myelin sheath EGFP expression decreased amount, abnormal	ue2Tg + CRISPR1-vps16	standard conditions	Figure 7 from Sofou et al., 2021
midbrain myelination disrupted, abnormal	ue2Tg + CRISPR1-vps16	standard conditions	Figure 7 from Sofou et al., 2021
brain EGFP expression increased amount, abnormal	zf155Tg + CRISPR1-vps16	standard conditions	Figure 8 from Sofou et al., 2021
optic tectum EGFP expression increased amount, abnormal	zf155Tg + CRISPR1-vps16	standard conditions	Figure 8 from Sofou et al., 2021

Citations