CRISPR

CRISPR1-vps41

ID

ZDB-CRISPR-220105-1

Name

CRISPR1-vps41

Previous Names

None

Target

Sequence

5' - GGGCTCTCGGGACGCACTTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

No data available

Expression

Gene expression in Wild Types + CRISPR1-vps41

Expressed Gene	Anatomy	Figures
aldoca	Purkinje cell	Fig. S11 from Sanderson et al., 2021

Phenotype

Phenotype resulting from CRISPR1-vps41

Phenotype	Fish	Figures
brain increased acidity, abnormal	WT + CRISPR1-vps41	Fig. 3 from Sanderson et al., 2021
integument decreased pigmentation, abnormal	WT + CRISPR1-vps41	Fig. 3 from Sanderson et al., 2021
melanocyte morphology, abnormal	WT + CRISPR1-vps41	Fig. 3 from Sanderson et al., 2021
microglial cell swollen, abnormal	WT + CRISPR1-vps41	Fig. S11 from Sanderson et al., 2021
microglial cell lysosome increased amount, abnormal	WT + CRISPR1-vps41	Fig. 3 from Sanderson et al., 2021
optokinetic behavior process quality, abnormal	WT + CRISPR1-vps41	Fig. 3 from Sanderson et al., 2021
optomotor response process quality, abnormal	WT + CRISPR1-vps41	Fig. 3 from Sanderson et al., 2021
Purkinje cell aldoca expression spatial pattern, abnormal	WT + CRISPR1-vps41	Fig. S11 from Sanderson et al., 2021
retinal pigmented epithelium decreased pigmentation, abnormal	WT + CRISPR1-vps41	Fig. 3 from Sanderson et al., 2021
swim bladder uninflated, abnormal	WT + CRISPR1-vps41	Fig. 3 from Sanderson et al., 2021
whole organism decreased length, abnormal	WT + CRISPR1-vps41	Fig. 3 from Sanderson et al., 2021

Phenotype of all Fish created by or utilizing CRISPR1-vps41

Phenotype	Fish	Conditions	Figures
optokinetic behavior process quality, abnormal	WT + CRISPR1-vps41	standard conditions	Fig. 3 from Sanderson et al., 2021
melanocyte morphology, abnormal	WT + CRISPR1-vps41	standard conditions	Fig. 3 from Sanderson et al., 2021
optomotor response process quality, abnormal	WT + CRISPR1-vps41	standard conditions	Fig. 3 from Sanderson et al., 2021
integument decreased pigmentation, abnormal	WT + CRISPR1-vps41	standard conditions	Fig. 3 from Sanderson et al., 2021
retinal pigmented epithelium decreased pigmentation, abnormal	WT + CRISPR1-vps41	standard conditions	Fig. 3 from Sanderson et al., 2021
brain increased acidity, abnormal	WT + CRISPR1-vps41	standard conditions	Fig. 3 from Sanderson et al., 2021
microglial cell lysosome increased amount, abnormal	WT + CRISPR1-vps41	standard conditions	Fig. 3 from Sanderson et al., 2021
microglial cell swollen, abnormal	WT + CRISPR1-vps41	standard conditions	Fig. S11 from Sanderson et al., 2021
whole organism decreased length, abnormal	WT + CRISPR1-vps41	standard conditions	Fig. 3 from Sanderson et al., 2021
Purkinje cell aldoca expression spatial pattern, abnormal	WT + CRISPR1-vps41	standard conditions	Fig. S11 from Sanderson et al., 2021
swim bladder uninflated, abnormal	WT + CRISPR1-vps41	standard conditions	Fig. 3 from Sanderson et al., 2021

Citations