CRISPR

CRISPR2-pi4kb

ID

ZDB-CRISPR-211213-2

Name

CRISPR2-pi4kb

Previous Names

None

Target

pi4kb (1)

Sequence

5' - GGTTGCTGGCGGTTCTCTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "AGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3540	pi4kb
zf3541	pi4kb

Expression

Gene expression in Wild Types + CRISPR2-pi4kb

No data available

Phenotype

Phenotype resulting from CRISPR2-pi4kb

No data available

Phenotype of all Fish created by or utilizing CRISPR2-pi4kb

Phenotype	Fish	Conditions	Figures
auditory receptor cell morphology, abnormal	pi4kb^{zf3540/zf3540}	standard conditions	Fig. 3 from Feng et al., 2020
yolk syncytial layer edematous, abnormal	pi4kb^{zf3540/zf3540}	standard conditions	Fig. S2 from Feng et al., 2020
eye hemorrhagic, abnormal	pi4kb^{zf3540/zf3540}	standard conditions	Fig. S2 from Feng et al., 2020
saccule cilium decreased amount, abnormal	pi4kb^{zf3540/zf3540}	standard conditions	Fig. 3 from Feng et al., 2020
sensory perception of sound disrupted, abnormal	pi4kb^{zf3540/zf3540}	standard conditions	Fig. 4 from Feng et al., 2020
whole organism decreased life span, abnormal	pi4kb^{zf3540/zf3540}	standard conditions	Fig. S2 from Feng et al., 2020
eye edematous, abnormal	pi4kb^{zf3540/zf3540}	standard conditions	Fig. S2 from Feng et al., 2020
auditory receptor cell mitochondrion swollen, abnormal	pi4kb^{zf3540/zf3540}	standard conditions	Fig. 3 from Feng et al., 2020
eye decreased size, abnormal	pi4kb^{zf3540/zf3540}	standard conditions	Fig. S2 from Feng et al., 2020
whole organism dead, abnormal	pi4kb^{zf3540/zf3540}	standard conditions	Fig. S2 from Feng et al., 2020
pericardium edematous, abnormal	pi4kb^{zf3540/zf3540}	standard conditions	Fig. S2 from Feng et al., 2020
yolk syncytial layer edematous, abnormal	pi4kb^{zf3541/zf3541}	standard conditions	Fig. S2 from Feng et al., 2020
eye hemorrhagic, abnormal	pi4kb^{zf3541/zf3541}	standard conditions	Fig. S2 from Feng et al., 2020
whole organism decreased life span, abnormal	pi4kb^{zf3541/zf3541}	standard conditions	Fig. S2 from Feng et al., 2020
eye edematous, abnormal	pi4kb^{zf3541/zf3541}	standard conditions	Fig. S2 from Feng et al., 2020
whole organism dead, abnormal	pi4kb^{zf3541/zf3541}	standard conditions	Fig. S2 from Feng et al., 2020
eye decreased size, abnormal	pi4kb^{zf3541/zf3541}	standard conditions	Fig. S2 from Feng et al., 2020
pericardium edematous, abnormal	pi4kb^{zf3541/zf3541}	standard conditions	Fig. S2 from Feng et al., 2020
pillar of the semicircular canal morphology, abnormal	pi4kb^{zf3540/zf3540}; s356tTg	standard conditions	Fig. 3 from Feng et al., 2020
otic vesicle decreased size, abnormal	pi4kb^{zf3540/zf3540}; s356tTg	standard conditions	Fig. 3 from Feng et al., 2020
semicircular canal morphology, abnormal	pi4kb^{zf3540/zf3540}; s356tTg	standard conditions	Fig. 3 from Feng et al., 2020
anterior crista cilium decreased amount, abnormal	pi4kb^{zf3540/zf3540}; s356tTg	standard conditions	Fig. 3 from Feng et al., 2020
posterior crista cilium decreased amount, abnormal	pi4kb^{zf3540/zf3540}; s356tTg	standard conditions	Fig. 3 from Feng et al., 2020
neuromast hair cell cilium decreased amount, abnormal	pi4kb^{zf3540/zf3540}; s356tTg	standard conditions	Fig. 3 from Feng et al., 2020
lateral crista cilium decreased amount, abnormal	pi4kb^{zf3540/zf3540}; s356tTg	standard conditions	Fig. 3 from Feng et al., 2020
pillar of the semicircular canal morphology, abnormal	pi4kb^{zf3541/zf3541}; s356tTg	standard conditions	Fig. 3 from Feng et al., 2020
otic vesicle decreased size, abnormal	pi4kb^{zf3541/zf3541}; s356tTg	standard conditions	Fig. 3 from Feng et al., 2020
semicircular canal morphology, abnormal	pi4kb^{zf3541/zf3541}; s356tTg	standard conditions	Fig. 3 from Feng et al., 2020
anterior crista cilium decreased amount, abnormal	pi4kb^{zf3541/zf3541}; s356tTg	standard conditions	Fig. 3 from Feng et al., 2020
neuromast hair cell cilium decreased amount, abnormal	pi4kb^{zf3541/zf3541}; s356tTg	standard conditions	Fig. 3 from Feng et al., 2020
posterior crista cilium decreased amount, abnormal	pi4kb^{zf3541/zf3541}; s356tTg	standard conditions	Fig. 3 from Feng et al., 2020
lateral crista cilium decreased amount, abnormal	pi4kb^{zf3541/zf3541}; s356tTg	standard conditions	Fig. 3 from Feng et al., 2020

Citations