CRISPR

CRISPR1-pnpla2

ID
ZDB-CRISPR-211116-6
Name
CRISPR1-pnpla2
Previous Names
None
Target
Sequence
5' - GGGTATTTATCACATCGGAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ecn8 pnpla2
Expression
Gene expression in Wild Types + CRISPR1-pnpla2
No data available
Phenotype
Phenotype resulting from CRISPR1-pnpla2
No data available
Phenotype of all Fish created by or utilizing CRISPR1-pnpla2
Phenotype Fish Conditions Figures
whole organism gamma-linolenic acid increased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 1 from Han et al., 2021
hepatocyte mitochondrial chromosome increased amount, abnormal pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 8 from Han et al., 2021
liver fabp10a expression decreased amount, abnormal pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 5 from Han et al., 2021
liver atg5 expression increased amount, abnormal pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 5 from Han et al., 2021
whole organism phosphatidylethanolamine decreased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 1 from Han et al., 2021
whole organism phosphatidylcholine decreased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 1 from Han et al., 2021
liver map1lc3b expression decreased amount, abnormal pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 5 from Han et al., 2021
whole organism tetracosenoic acid decreased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 1 from Han et al., 2021
liver ulk1b expression decreased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 5 from Han et al., 2021
liver atg12 expression amount, ameliorated pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 5 from Han et al., 2021
liver white, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 1 from Han et al., 2021
liver hspa5 expression increased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 8 from Han et al., 2021
hepatocyte mitochondrion increased amount, abnormal pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 8 from Han et al., 2021
whole organism decreased weight, abnormal pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 4 from Han et al., 2021
liver il6 expression increased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 8 from Han et al., 2021
liver map1lc3b expression decreased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 5 from Han et al., 2021
liver atg12 expression decreased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 5 from Han et al., 2021
liver pnpla2 expression decreased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 5 from Han et al., 2021
hepatocyte mitochondrion increased size, abnormal pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 8 from Han et al., 2021
whole organism oxygen metabolic process decreased magnitude, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 1 from Han et al., 2021
hepatocyte lipid droplet increased size, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 4 from Han et al., 2021
whole organism docosahexaenoic acid decreased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 1 from Han et al., 2021
liver lipea expression increased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 5 from Han et al., 2021
liver abhd5a expression increased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 5 from Han et al., 2021
liver lipea expression decreased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 5 from Han et al., 2021
liver tfeb expression increased amount, abnormal pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 5 from Han et al., 2021
liver mgll expression decreased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 5 from Han et al., 2021
liver il6 expression increased amount, abnormal pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 8 from Han et al., 2021
liver atg4a expression decreased amount, abnormal pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 5 from Han et al., 2021
whole organism triglyceride increased amount, exacerbated pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 4 from Han et al., 2021
liver pnpla2 expression decreased amount, abnormal pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 5 from Han et al., 2021
liver ssbp1 expression increased amount, abnormal pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 8 from Han et al., 2021
liver ulk1b expression amount, ameliorated pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 5 from Han et al., 2021
liver atg4a expression decreased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 5 from Han et al., 2021
whole organism triglyceride increased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 1,  Fig. 4 from Han et al., 2021
liver vacuolated, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 1 from Han et al., 2021
liver il1b expression increased amount, abnormal pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 8 from Han et al., 2021
liver fabp10a expression decreased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 5 from Han et al., 2021
whole organism protein decreased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 1 from Han et al., 2021
liver tnfa expression increased amount, abnormal pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 8 from Han et al., 2021
whole organism lipid increased amount, abnormal pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 4 from Han et al., 2021
whole organism hexadecenoic acid increased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 1 from Han et al., 2021
whole organism decreased weight, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 1,  Fig. 4 from Han et al., 2021
liver becn1 expression amount, ameliorated pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 5 from Han et al., 2021
liver hspa5 expression increased amount, abnormal pnpla2ecn8/ecn8 (AB) chemical treatment by diet: 3-methyladenine Fig. 8 from Han et al., 2021
liver lipeb expression decreased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 5 from Han et al., 2021
liver atg7 expression decreased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 5 from Han et al., 2021
liver becn1 expression decreased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 5 from Han et al., 2021
whole organism elaidic acid increased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 1 from Han et al., 2021
liver vacuole increased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 1 from Han et al., 2021
liver fatty, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 1 from Han et al., 2021
whole organism icosenoic acid decreased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 1 from Han et al., 2021
liver plin2 expression decreased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 5 from Han et al., 2021
whole organism lipid increased amount, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 1,  Fig. 4 from Han et al., 2021
swimming decreased linear velocity, abnormal pnpla2ecn8/ecn8 (AB) standard conditions Fig. 1 from Han et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.