CRISPR

CRISPR1-bag3

ID
ZDB-CRISPR-210629-7
Name
CRISPR1-bag3
Previous Names
None
Target
Sequence
5' - GTCATGAAAACCCTGAACCCAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ulm104 bag3
Expression
Gene expression in Wild Types + CRISPR1-bag3
No data available
Phenotype
Phenotype resulting from CRISPR1-bag3
No data available
Phenotype of all Fish created by or utilizing CRISPR1-bag3
No data available
Citations