CRISPR

CRISPR1-exosc5

ID

ZDB-CRISPR-210316-1

Name

CRISPR1-exosc5

Previous Names

None

Target

exosc5 (1)

Sequence

5' - GGGGACACGAGTATCCTGGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
s4003	exosc5
s4004	exosc5
s4005	exosc5

Expression

Gene expression in Wild Types + CRISPR1-exosc5

No data available

Phenotype

Phenotype resulting from CRISPR1-exosc5

Phenotype	Fish	Figures
brain morphology, abnormal	zf148Tg + CRISPR1-exosc5	Fig. 3 from Slavotinek et al., 2020
brain development disrupted, abnormal	zf148Tg + CRISPR1-exosc5	Fig. 3 from Slavotinek et al., 2020
eye decreased size, abnormal	ku20Tg + CRISPR1-exosc5	Fig. 2, Fig. 3 from Slavotinek et al., 2020
fin morphology, abnormal	EKW + CRISPR1-exosc5	Fig. 2 from Slavotinek et al., 2020
head decreased size, abnormal	ku20Tg + CRISPR1-exosc5	Fig. 2, Fig. 3 from Slavotinek et al., 2020
midbrain decreased size, abnormal	EKW + CRISPR1-exosc5	Fig. 2 from Slavotinek et al., 2020
post-vent region decreased length, abnormal	ku20Tg + CRISPR1-exosc5	Fig. 2, Fig. 3 from Slavotinek et al., 2020
post-vent region increased curvature, abnormal	EKW + CRISPR1-exosc5	Fig. 2 from Slavotinek et al., 2020
spinal cord morphology, abnormal	zf148Tg + CRISPR1-exosc5	Fig. 3 from Slavotinek et al., 2020
telencephalon decreased size, abnormal	EKW + CRISPR1-exosc5	Fig. 2 from Slavotinek et al., 2020
trunk decreased length, abnormal	EKW + CRISPR1-exosc5	Fig. 2, Fig. 3 from Slavotinek et al., 2020

Phenotype of all Fish created by or utilizing CRISPR1-exosc5

Phenotype	Fish	Conditions	Figures
post-vent region decreased length, abnormal	EKW + CRISPR1-exosc5	standard conditions	Fig. 2 from Slavotinek et al., 2020
midbrain decreased size, abnormal	EKW + CRISPR1-exosc5	standard conditions	Fig. 2 from Slavotinek et al., 2020
eye decreased size, abnormal	EKW + CRISPR1-exosc5	standard conditions	Fig. 2 from Slavotinek et al., 2020
head decreased size, abnormal	EKW + CRISPR1-exosc5	standard conditions	Fig. 2 from Slavotinek et al., 2020
trunk decreased length, abnormal	EKW + CRISPR1-exosc5	standard conditions	Fig. 2 from Slavotinek et al., 2020
fin morphology, abnormal	EKW + CRISPR1-exosc5	standard conditions	Fig. 2 from Slavotinek et al., 2020
post-vent region increased curvature, abnormal	EKW + CRISPR1-exosc5	standard conditions	Fig. 2 from Slavotinek et al., 2020
telencephalon decreased size, abnormal	EKW + CRISPR1-exosc5	standard conditions	Fig. 2 from Slavotinek et al., 2020
eye decreased size, abnormal	ku20Tg + CRISPR1-exosc5	standard conditions	Fig. 3 from Slavotinek et al., 2020
post-vent region decreased length, abnormal	ku20Tg + CRISPR1-exosc5	standard conditions	Fig. 3 from Slavotinek et al., 2020
brain development disrupted, abnormal	ku20Tg + CRISPR1-exosc5	standard conditions	Fig. 3 from Slavotinek et al., 2020
trunk decreased length, abnormal	ku20Tg + CRISPR1-exosc5	standard conditions	Fig. 3 from Slavotinek et al., 2020
head decreased size, abnormal	ku20Tg + CRISPR1-exosc5	standard conditions	Fig. 3 from Slavotinek et al., 2020
brain development disrupted, abnormal	zf148Tg + CRISPR1-exosc5	standard conditions	Fig. 3 from Slavotinek et al., 2020
brain morphology, abnormal	zf148Tg + CRISPR1-exosc5	standard conditions	Fig. 3 from Slavotinek et al., 2020
spinal cord morphology, abnormal	zf148Tg + CRISPR1-exosc5	standard conditions	Fig. 3 from Slavotinek et al., 2020

Citations