CRISPR

CRISPR2-togaram1

ID

ZDB-CRISPR-210223-4

Name

CRISPR2-togaram1

Previous Names

None

Target

togaram1 (1)

Sequence

5' - GGTGAATCTGCGCGCTCTGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zh508	togaram1
zh509	togaram1
zh510	togaram1

Expression

Gene expression in Wild Types + CRISPR2-togaram1

No data available

Phenotype

Phenotype resulting from CRISPR2-togaram1

No data available

Phenotype of all Fish created by or utilizing CRISPR2-togaram1

Phenotype	Fish	Conditions	Figures
tectal ventricle cilium arl13b expression spatial pattern, abnormal	togaram1^zh508/zh508	standard conditions	Fig. 4 from Latour et al., 2020
olfactory pit cilium arl13b expression spatial pattern, abnormal	togaram1^zh508/zh508	standard conditions	Fig. 4 from Latour et al., 2020
pronephric duct cilium arl13b expression spatial pattern, abnormal	togaram1^zh508/zh508	standard conditions	Fig. 4 from Latour et al., 2020
pronephric duct cilium decreased length, abnormal	togaram1^zh508/zh508	standard conditions	Fig. 4 from Latour et al., 2020
kidney cystic, abnormal	togaram1^zh508/zh508	standard conditions	Fig. 4 from Latour et al., 2020
whole organism curved, abnormal	togaram1^zh508/zh508	standard conditions	Fig. 4 from Latour et al., 2020
tectal ventricle cilium decreased length, abnormal	togaram1^zh508/zh508	standard conditions	Fig. 4 from Latour et al., 2020
olfactory pit cilium decreased amount, abnormal	togaram1^zh508/zh508	standard conditions	Fig. 4 from Latour et al., 2020
pronephric duct cilium decreased amount, abnormal	togaram1^zh508/zh508	standard conditions	Fig. 4 from Latour et al., 2020
tectal ventricle cilium arl13b expression spatial pattern, abnormal	togaram1^zh509/zh509	standard conditions	Fig. 4 from Latour et al., 2020
olfactory pit cilium arl13b expression spatial pattern, abnormal	togaram1^zh509/zh509	standard conditions	Fig. 4 from Latour et al., 2020
pronephric duct cilium arl13b expression spatial pattern, abnormal	togaram1^zh509/zh509	standard conditions	Fig. 4 from Latour et al., 2020
pronephric duct cilium decreased length, abnormal	togaram1^zh509/zh509	standard conditions	Fig. 4 from Latour et al., 2020
olfactory pit cilium decreased amount, abnormal	togaram1^zh509/zh509	standard conditions	Fig. 4 from Latour et al., 2020
kidney cystic, abnormal	togaram1^zh509/zh509	standard conditions	Fig. 4 from Latour et al., 2020
whole organism curved, abnormal	togaram1^zh509/zh509	standard conditions	Fig. 4 from Latour et al., 2020
tectal ventricle cilium decreased length, abnormal	togaram1^zh509/zh509	standard conditions	Fig. 4 from Latour et al., 2020
pronephric duct cilium decreased amount, abnormal	togaram1^zh509/zh509	standard conditions	Fig. 4 from Latour et al., 2020
olfactory pit cilium arl13b expression spatial pattern, abnormal	togaram1^zh510/zh510	standard conditions	Fig. 4 from Latour et al., 2020
pronephric duct cilium arl13b expression spatial pattern, abnormal	togaram1^zh510/zh510	standard conditions	Fig. 4 from Latour et al., 2020
olfactory pit cilium decreased amount, abnormal	togaram1^zh510/zh510	standard conditions	Fig. 4 from Latour et al., 2020
pronephric duct cilium decreased length, abnormal	togaram1^zh510/zh510	standard conditions	Fig. 4 from Latour et al., 2020
tectal ventricle cilium arl13b expression spatial pattern, abnormal	togaram1^zh510/zh510	standard conditions	Fig. 4 from Latour et al., 2020
kidney cystic, abnormal	togaram1^zh510/zh510	standard conditions	Fig. 4 from Latour et al., 2020
tectal ventricle cilium decreased length, abnormal	togaram1^zh510/zh510	standard conditions	Fig. 4 from Latour et al., 2020
whole organism curved, abnormal	togaram1^zh510/zh510	standard conditions	Fig. 4 from Latour et al., 2020
pronephric duct cilium decreased amount, abnormal	togaram1^zh510/zh510	standard conditions	Fig. 4 from Latour et al., 2020

Citations