CRISPR

CRISPR3-snord118a

ID

ZDB-CRISPR-201117-3

Name

CRISPR3-snord118a

Previous Names

None

Target

snord118a (1)

Sequence

5' - GGCGCCGGCGTAGAGACGAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "TGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ue501	snord118a

Expression

Gene expression in Wild Types + CRISPR3-snord118a

No data available

Phenotype

Phenotype resulting from CRISPR3-snord118a

No data available

Phenotype of all Fish created by or utilizing CRISPR3-snord118a

Phenotype	Fish	Conditions	Figures
whole organism ccng1 expression increased amount, abnormal	snord118a^ue501/ue501	standard conditions	Fig. 6, Fig. S12 from Badrock et al., 2020
whole organism baxa expression increased amount, abnormal	snord118a^ue501/ue501	standard conditions	Fig. 6, Fig. S12 from Badrock et al., 2020
whole organism decreased life span, abnormal	snord118a^ue501/ue501	standard conditions	Fig. S4 from Badrock et al., 2020
whole organism cdkn1a expression increased amount, abnormal	snord118a^ue501/ue501	standard conditions	Fig. 6, Fig. S12 from Badrock et al., 2020
whole organism dead, abnormal	snord118a^ue501/ue501	standard conditions	Fig. S4 from Badrock et al., 2020
whole organism mdm2 expression increased amount, abnormal	snord118a^ue501/ue501	standard conditions	Fig. 6, Fig. S12 from Badrock et al., 2020
whole organism decreased length, abnormal	snord118a^ue501/ue501; s843Tg	standard conditions	Fig. 2 from Badrock et al., 2020
yolk morphology, abnormal	snord118a^ue501/ue501; s843Tg	standard conditions	Fig. S3 from Badrock et al., 2020
sprouting angiogenesis disrupted, abnormal	snord118a^ue501/ue501; s843Tg	standard conditions	Fig. 2 from Badrock et al., 2020
extension morphology, abnormal	snord118a^ue501/ue501; s843Tg	standard conditions	Fig. 2 from Badrock et al., 2020
melanocyte differentiation disrupted, abnormal	snord118a^ue501/ue501; s843Tg	standard conditions	Fig. 2 from Badrock et al., 2020
trunk vasculature disorganized, abnormal	snord118a^ue501/ue501; s843Tg	standard conditions	Fig. 2, Fig. S3 from Badrock et al., 2020
heart edematous, abnormal	snord118a^ue501/ue501; s843Tg	standard conditions	Fig. S3 from Badrock et al., 2020
angiogenic sprout decreased amount, abnormal	snord118a^ue501/ue501; s843Tg	standard conditions	Fig. 2, Fig. 6 from Badrock et al., 2020
midbrain hindbrain boundary morphology, abnormal	snord118a^ue501/ue501; s843Tg	standard conditions	Fig. 2 from Badrock et al., 2020
whole organism mitochondrial small ribosomal subunit decreased amount, abnormal	snord118a^ue501/ue501; s843Tg	standard conditions	Fig. 2 from Badrock et al., 2020
eye decreased size, abnormal	snord118a^ue501/ue501; s843Tg	standard conditions	Fig. 2 from Badrock et al., 2020
hindbrain swollen, abnormal	snord118a^ue501/ue501; s843Tg	standard conditions	Fig. 2, Fig. S3 from Badrock et al., 2020
embryonic cranial skeleton morphogenesis disrupted, abnormal	snord118a^ue501/ue501; s843Tg	standard conditions	Fig. S3 from Badrock et al., 2020
intestine immature, abnormal	snord118a^ue501/ue501; s843Tg	standard conditions	Fig. S3 from Badrock et al., 2020
swim bladder uninflated, abnormal	snord118a^ue501/ue501; s843Tg	standard conditions	Fig. S3 from Badrock et al., 2020
hindbrain Venus expression increased amount, abnormal	snord118a^ue501/ue501; ue503Tg	standard conditions	Fig. 6, Fig. S12 from Badrock et al., 2020
embryo development delayed, abnormal	snord118a^ue501/ue501; ue503Tg	standard conditions	Fig. S12 from Badrock et al., 2020
fourth ventricle swollen, abnormal	snord118a^ue501/ue501; ue503Tg	standard conditions	Fig. S12 from Badrock et al., 2020
somite Venus expression increased amount, abnormal	snord118a^ue501/ue501; ue503Tg	standard conditions	Fig. 6, Fig. S12 from Badrock et al., 2020
whole organism Venus expression increased amount, abnormal	snord118a^ue501/ue501; ue503Tg	standard conditions	Fig. S12 from Badrock et al., 2020
eye decreased size, abnormal	snord118a^ue501/ue501; ue503Tg	standard conditions	Fig. S12 from Badrock et al., 2020
eye Venus expression increased amount, abnormal	snord118a^ue501/ue501; ue503Tg	standard conditions	Fig. 6, Fig. S12 from Badrock et al., 2020
whole organism cdkn1a expression amount, ameliorated	tp53^zdf1/zdf1; snord118a^ue501/ue501	standard conditions	Fig. 6 from Badrock et al., 2020
whole organism mdm2 expression amount, ameliorated	tp53^zdf1/zdf1; snord118a^ue501/ue501	standard conditions	Fig. 6 from Badrock et al., 2020
whole organism baxa expression amount, ameliorated	tp53^zdf1/zdf1; snord118a^ue501/ue501	standard conditions	Fig. 6 from Badrock et al., 2020
whole organism decreased length, abnormal	tp53^zdf1/zdf1; snord118a^ue501/ue501; s843Tg	standard conditions	Fig. S13 from Badrock et al., 2020
angiogenic sprout amount, ameliorated	tp53^zdf1/zdf1; snord118a^ue501/ue501; s843Tg	standard conditions	Fig. 6 from Badrock et al., 2020
extension morphology, abnormal	tp53^zdf1/zdf1; snord118a^ue501/ue501; s843Tg	standard conditions	Fig. S13 from Badrock et al., 2020
trunk vasculature morphology, ameliorated	tp53^zdf1/zdf1; snord118a^ue501/ue501; s843Tg	standard conditions	Fig. S13 from Badrock et al., 2020
whole organism mitochondrial small ribosomal subunit decreased amount, abnormal	tp53^zdf1/zdf1; snord118a^ue501/ue501; s843Tg	standard conditions	Fig. S13 from Badrock et al., 2020
hindbrain size, ameliorated	tp53^zdf1/zdf1; snord118a^ue501/ue501; s843Tg	standard conditions	Fig. S13 from Badrock et al., 2020

Citations