CRISPR
CRISPR3-en.gata2a.i4
- ID
- ZDB-CRISPR-200821-14
- Name
- CRISPR3-en.gata2a.i4
- Previous Names
-
- sgRNA3 targets intron 4 (1)
- Target
- Sequence
-
5' - GATGTCATTCGGGCCTGCCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
| Genomic Feature | Affected Genomic Regions |
|---|---|
| hg123 | en.gata2a.i4 |
| uob101 | en.gata2a.i4 |
Expression
Gene expression in Wild Types + CRISPR3-en.gata2a.i4
No data available
Phenotype
Phenotype resulting from CRISPR3-en.gata2a.i4
No data available
Phenotype of all Fish created by or utilizing CRISPR3-en.gata2a.i4
Citations