CRISPR

CRISPR3-dstyk

ID
ZDB-CRISPR-200708-7
Name
CRISPR3-dstyk
Previous Names
None
Target
Sequence
5' - GGAGAGCTTCGTGGGAACAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3306 dstyk
zf3307 dstyk
Expression
Gene expression in Wild Types + CRISPR3-dstyk
No data available
Phenotype
Phenotype resulting from CRISPR3-dstyk
No data available
Phenotype of all Fish created by or utilizing CRISPR3-dstyk
No data available
Citations