CRISPR

CRISPR1-rps9

ID
ZDB-CRISPR-200528-2
Name
CRISPR1-rps9
Previous Names
None
Target
Sequence
5' - GCGTATTGGAGTGCTGGATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
la489 rps9
la490 rps9
la491 rps9
Expression
Gene expression in Wild Types + CRISPR1-rps9
No data available
Phenotype
Phenotype resulting from CRISPR1-rps9
No data available
Phenotype of all Fish created by or utilizing CRISPR1-rps9
No data available
Citations