CRISPR

CRISPR12-kmt2d

ID
ZDB-CRISPR-200515-2
Name
CRISPR12-kmt2d
Previous Names
None
Target
Sequence
5' - GTATTGACTGTGGCATGCGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zy58 kmt2d
zy59 kmt2d
zy60 kmt2d
Expression
Gene expression in Wild Types + CRISPR12-kmt2d
No data available
Phenotype
Phenotype resulting from CRISPR12-kmt2d
No data available
Phenotype of all Fish created by or utilizing CRISPR12-kmt2d
No data available
Citations