CRISPR

CRISPR3-tlx1

ID

ZDB-CRISPR-200429-4

Name

CRISPR3-tlx1

Previous Names

None

Target

tlx1 (1)

Sequence

5' - GGGTCCTACAACATGAACTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
cq201	tlx1
cq202	tlx1

Expression

Gene expression in Wild Types + CRISPR3-tlx1

No data available

Phenotype

Phenotype resulting from CRISPR3-tlx1

No data available

Phenotype of all Fish created by or utilizing CRISPR3-tlx1

Phenotype	Fish	Conditions	Figures
trunk apoptotic process increased occurrence, abnormal	tlx1^cq201/cq201	bacterial treatment by exposure to environment: Aeromonas hydrophila	Figure 1 from Xie et al., 2021
whole organism nfkb2 expression increased amount, abnormal	tlx1^cq201/cq201	bacterial treatment by exposure to environment: Aeromonas hydrophila	Figure 1 from Xie et al., 2021
liver tnfa expression increased amount, abnormal	tlx1^cq201/cq201	vaccine treatment: Aeromonas hydrophila	Figure 4 from Xie et al., 2021
liver il6 expression increased amount, abnormal	tlx1^cq201/cq201	vaccine treatment: Aeromonas hydrophila	Figure 4 from Xie et al., 2021
kidney mhc2dhb expression decreased amount, abnormal	tlx1^cq201/cq201	vaccine treatment: Aeromonas hydrophila	Figure 9 from Xie et al., 2021
liver il10 expression increased amount, abnormal	tlx1^cq201/cq201	vaccine treatment: Aeromonas hydrophila	Figure 4 from Xie et al., 2021
liver tnfb expression increased amount, abnormal	tlx1^cq201/cq201	vaccine treatment: Aeromonas hydrophila	Figure 4 from Xie et al., 2021
gut left side tlx1 expression absent, abnormal	tlx1^cq201/cq201	standard conditions	Fig. 3 from Xie et al., 2019
whole organism decreased life span, exacerbated	tlx1^cq201/cq201	bacterial treatment by injection: Aeromonas hydrophila	Fig. 5 from Xie et al., 2019
liver il1b expression increased amount, abnormal	tlx1^cq201/cq201	vaccine treatment: Aeromonas hydrophila	Figure 4 from Xie et al., 2021
immune response decreased process quality, abnormal	tlx1^cq201/cq201	vaccine treatment: Aeromonas hydrophila	Figure 9 from Xie et al., 2021
whole organism nfkb2 expression increased amount, abnormal	tlx1^cq201/cq201	chemical treatment by environment: lipopolysaccharide	Figure 1 from Xie et al., 2021
whole organism il10 expression increased amount, abnormal	tlx1^cq201/cq201	bacterial treatment by exposure to environment: Aeromonas hydrophila	Figure 1 from Xie et al., 2021
intestine nfkb2 expression increased amount, abnormal	tlx1^cq201/cq201	vaccine treatment: Aeromonas hydrophila	Figure 4 from Xie et al., 2021
whole organism tnfb expression increased amount, abnormal	tlx1^cq201/cq201	chemical treatment by environment: lipopolysaccharide	Figure 1 from Xie et al., 2021
intestine tnfa expression increased amount, abnormal	tlx1^cq201/cq201	vaccine treatment: Aeromonas hydrophila	Figure 4 from Xie et al., 2021
whole organism il10 expression increased amount, abnormal	tlx1^cq201/cq201	chemical treatment by environment: lipopolysaccharide	Figure 1 from Xie et al., 2021
kidney ighm expression decreased amount, abnormal	tlx1^cq201/cq201	vaccine treatment: Aeromonas hydrophila	Figure 9 from Xie et al., 2021
intestine il10 expression increased amount, abnormal	tlx1^cq201/cq201	vaccine treatment: Aeromonas hydrophila	Figure 4 from Xie et al., 2021
spleen absent, abnormal	tlx1^cq201/cq201	standard conditions	Fig. 4 from Xie et al., 2019
whole organism il1b expression increased amount, abnormal	tlx1^cq201/cq201	chemical treatment by environment: lipopolysaccharide	Figure 1 from Xie et al., 2021
whole organism il6 expression increased amount, abnormal	tlx1^cq201/cq201	chemical treatment by environment: lipopolysaccharide	Figure 1 from Xie et al., 2021
intestine il1b expression increased amount, abnormal	tlx1^cq201/cq201	vaccine treatment: Aeromonas hydrophila	Figure 4 from Xie et al., 2021
liver nfkb2 expression increased amount, abnormal	tlx1^cq201/cq201	vaccine treatment: Aeromonas hydrophila	Figure 4 from Xie et al., 2021
intestine il6 expression increased amount, abnormal	tlx1^cq201/cq201	vaccine treatment: Aeromonas hydrophila	Figure 4 from Xie et al., 2021
trunk apoptotic process increased occurrence, abnormal	tlx1^cq201/cq201	chemical treatment by environment: lipopolysaccharide	Figure 1 from Xie et al., 2021
whole organism tnfa expression increased amount, abnormal	tlx1^cq201/cq201	bacterial treatment by exposure to environment: Aeromonas hydrophila	Figure 1 from Xie et al., 2021
intestine tnfb expression increased amount, abnormal	tlx1^cq201/cq201	vaccine treatment: Aeromonas hydrophila	Figure 4 from Xie et al., 2021
whole organism tnfa expression increased amount, abnormal	tlx1^cq201/cq201	chemical treatment by environment: lipopolysaccharide	Figure 1 from Xie et al., 2021
whole organism il6 expression increased amount, abnormal	tlx1^cq201/cq201	bacterial treatment by exposure to environment: Aeromonas hydrophila	Figure 1 from Xie et al., 2021
whole organism il1b expression increased amount, abnormal	tlx1^cq201/cq201	bacterial treatment by exposure to environment: Aeromonas hydrophila	Figure 1 from Xie et al., 2021
whole organism tnfb expression increased amount, abnormal	tlx1^cq201/cq201	bacterial treatment by exposure to environment: Aeromonas hydrophila	Figure 1 from Xie et al., 2021
gut left side tlx1 expression absent, abnormal	tlx1^cq202/cq202	standard conditions	Fig. 3 from Xie et al., 2019
whole organism decreased life span, exacerbated	tlx1^cq202/cq202	bacterial treatment by injection: Aeromonas hydrophila	Fig. 5 from Xie et al., 2019
spleen absent, abnormal	tlx1^cq202/cq202	standard conditions	Fig. 4 from Xie et al., 2019

Citations